Transcript asmbl_23619

Sequence
Transcript Sequence for observation asmbl_23619 of TGE0057001:
GGTTAATAAACAGCTTTATTTGCCTTGTACAGCATCAATTTTCTTACATTCTCAGTTAATTGGCCATTAAAGTGCTGGAAATTTTCTTAATCATGATAACATTTGTTAAAAAGAAATCAGAACTAATATCAGGAACATGGCGGCATGAAGGAAACAGTTCCCTTACAAAACACAGAAAATGGAAGCCCCTCATGTTGAGGGGGTGGGTTGGACAATTTGCAAACAGATTCTAATTTCCTCTCACCGTCAGCACCAAACTGGCTGGGACCACCACCCCTGGGTGAAAGAAACAACACTAAAGAACCCTAAAAACACCCACACACCCTGACTACCACCACCTCTGGGCCATCTGTGGGCGTTTGCTGTTTGAACAGATCCAGTCTCAGGAAAGAGGAAGACCTGACCTCCGTCTGCAACCCATCACCCCACCCACCCTTACTAACAAAAGCCCCCAAAGTCATTACAATGAAAAAGTGGGTTTCCATTACCCCAAAACTAACAATGTTCAGTAAAAATGAGGATAATAAACACAAAAGCTTGCTTAGTAAACAGGAGCTCTCAGCAGTCAATGCAAAAAAATATATATATATGAAATCTTAAGGCAAATACTGTTGACTTTGCACATGGGCTGGACGAACTTGGAACTCTTTACCTATCTGTATAGTTCCAGGAGCCTACAGGCGGTCGGTTTTTCAGCGCTTGCCACCGGGCCAGGCAAGGTCTTTGCATGATTGCTGAGGCAGTCGGTGTGTTTCCCTTTGGAGTTTATATAGGAACACACCACCCAAGGCTGATGTTTTGTTATATATATATATATGTACACACATACAAAGGCCTGCTACTCTTTCTTTGTGGAAACTGACAGCTCCACCTCGGGAAGCTGGATGCCAACCTTATTCCCACTGTCATTGCTAGAAGAGGAGGACAGTCGGGACTTCTTAGAGGCCAGGGACACCCCACTCCCCTGTAACTTGCCTGTCTCATCATCGCTCCCAGTCACCTCATAATGACCTTTGCTCTTTGACCCCAATCCACCAAAGGTACCGAATTTCAGCTTCCCGTGTTTCCCTTTAACTTTCCCACCTTCCAGAGACACTTCCCCACCTTCAAACTCCAGCGTCCCCGTCGGGGTGGAAGGTCCAGAGAACTCTCTTTCATCACTGAATGAATTTGAGCGGTGCCGTGGCTTCTTACTTTTAAATAAGGAGAATTTGCCTTTCGGTGAAGAGGCTTCGGCCTCTGCCTCTCCTTCCAGAGAGCCCAGGCTGGCCTTTGAACTTTTCAGGTCACCTTTGGACCCAGAAATTGATGCTTCTGGTGAGCCAGTGACACCACCTTTCCCTTTAGGTTTGGAAAAATTAAACTTGGGCATTTTGATCTTGGACTTTTTCAGTTTGACTTCAGACTCTTCCCACTCGCCGTCTCCAGCACCAGCTTGGATGCTGGCCTCTGCTTTAGGGAAGTGAACATCCACCCCCATTTCTCTGCCAACCAGCTCACGGCCAGAGAAGGTAAATTTGGGGATCTTCATTTTAGGGAATGTTACTTTTCCAGATCCACTTTCCAAGTGACCTTGAGGCCCAGACACACTCAGCCCAGGAGCCTGGAGTCCAATCTGACCTCCTTTCACACCTCCTTCCACCTTTGGTCCTGAGAAATGAAGGCCCCCAGCAAACTTAGATGTGTCCAAGTTGAGAGCAGAGGAGACTTGGGGTCCCTTCCACTCACCCCCGGAACCTTTAACACTCAAATGCCCTTCACCAAGGCTGATGTCTGGGGCACTGACACCCCCTGAAACATCCGCACCTCCTTTGATTTTTGGGCCCTTCAAGTTGATGCCAAAATCTGACTCAGGAGATGCCATATTAAAGGCAGGCCCCTTCACACTGATATCAGGAGCAGCCCCATGGAAACCTACTTCTGAACCTTTCAGACCACCTTTGATTTCAGGCCCAGAAATCTGCCCAGTTGGGAGTTTCACATTCACGCCTGGCAGGTTCACATCACATCCAGAGGACTTAATTCCAGGCATCTGGAGGTTTCCTTCTAGGCCTTGAACACCAATGCCTGGAAGACCTCCTCCGACAGTGGGGCCTTTGATCTCACCAGTGGCCCCAAGGCTCCCTTTCACTTTTGGTCCTTCCAAGTTAAAGTCCACATTCGGTGCTGAAATCCGAGGCCCTTTCAGGTTCACATCCACACCTGGCCCCTTCAGTTCGCCAGAAACCTGTGGCCCCTTGGCATTGACGTGCAAGTCGGACCCCGGAGTAGAGATGCCAAATTGGGGCAGCTTCATTTTGGGAAGTTTAATGCTGCCTTCGGATGCCTCCAAGCTTAGATCAGGAGCTCCTACGGATACTTTAGGGCATTTGATGTCACCAGAGACAGCCAGATCTCCCTGCAGGCTTGGTCCCCTCAGTGTCACATCTGGTGCCCCAACGTTAAGCTTTGTTGTGGCATCGATCCCTGGCACTTTCACACCGTCTCCTCCCACCTGCATTTTGCCACCGACACCACTGAGGTTGAGCCCTGGAGCATGCACCTTCATGCTGGGAACAGATGCATCCAGGTCTCCCTTCAAACTTGGTCCTTTCAAGTTCAGATCAAGGTCAGGCCCAGAGACTTTTGGCATAGAGAGGTTCACTGAAGGCAAGTCTACTCCTGGCCCCTTTAGAGAAACATCGGGCCCTTCGAGCTTAACATCTGGTCCTCTCAAGTCTCCTTCAAGAGAGGGTAGCTGGGCATGGACCTCGGCTCCCCCACCCTCCATTTTCACACCTGGGATGCCGATCTTGGGCATGGAAAACTTGGGGAACTTAATTTTTGCTTCTGGACCTTGCAGATCTACATCTGGTCCTTCCAGTCCCACGCTGGGGACATCACCCTTTATCTTTGGTCCTTTCAAGTTTACATTCACATCAGGGATGGAGACTTGAGGGGCAGAAATGCCGAAGGACGGTGTTTTGACTTTAGCATCTAGGCCTTCGATGTTGATGTCAGGTGCACCCAAGTTTGCCTGCACTTTGGGGCCTTTCAGGTCACCCTCTATTTTTGGCACTGAGATGTCCACATCTGGCATCTTGACCTTGGGAGCCTTCGCCTTGATGTCAAGACCTTCGACGTGAATCGCTGGCAAAGAAAGTTCCAGATCAGGTGCCTGGAGTTCACCCTCCAGTTTGGGGCTAGGGAGAGGGGCCTCAGCTTTAAATTTAGGTGATTTAATGTCAAACTCTACATCTGGGAAGTACATTTTTCCAAACATCGTTTTCTTGGTTTTGGGCGATTTCACGTCGACTTTGAGTGCAGCATCCGGCCCTGCGATGTTGACATCTACATCCGGAGCCTTGAGGCTGGCATCAATTTCACCCCCAGGAACATTCAGGTCAAATCCCTGTTTTTTGGCCTTAATCTTAGGACCACTCATATGAATTTTAGGCATTTTAAACTTACTTTTCTTGCCCTTGCCACCAACACTAATTTCAGGAGTCTCAAGGTTCAGCTCTGCCTCAGGAACAGTGACATCCAGTGAAGGTGACTTGATGTCAGCTTTGGGGCTTTTTGCCCCAAATCCAAACTTGGGTTTCTTAAATTTGGGGATTTTAACATCTGGCCCTTCGATGTTAATATCTGGGCTGTCCATGTGTACATCTAAGCTTGGAGCTTCAACTTTGGGTCCCTTGAGGTCCACTTCACCACCTTCTAACTTCGGACCTGAAAATCCAATTTTTGGTGCCTTGAGATGCAAATCAACATCAGGAGCAGTTACTTTAGGAGCAGATATCTCCAGCGATGGCATCTTCAAAGATGGGCCACTGAGTTTGGCATCAGGGCCTTCGAAATCCAGACGTGGACCTTTAAGATCTACTTCTGGGCCTTTCAAAGTCCCTTCAACCTTAGGGACAGACACATCAAAATCTCCTTTTACTTTGGGTCCTTTCAAATCCAGGTCAACATCAGGTATGGAGATCTTGGGAGCTTTGATATTTATTTCAGGCATCTTGAACTTGGGGCCCTTCAGTTTTGCGTCTGGACCTTCGATATTCACATCTGGAATATCAACGTCCACCTTGGGTCCCGAGACATCGATGTCGGCCTTGGGCAGGCTCACATCCACATCTGGACCTTCTCCTTTG