Transcript asmbl_21792

Sequence
Transcript Sequence for observation asmbl_21792 of TGE0057000:
GGTGCAAACACGCGGGTCAGCTGATCCGGCCCAACTGCGGCGTCATCCCGGCTATAAGCGCACGGCCTCGGCGACCCTCTCCGACCCGGCCGCCGCCGCCATGCAGCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCTGGCTGCACCCGCCTCCGCGCTCGTCAGGATCCCGCTGCACAAGTTCACGTCCATCCGCCGGACCATGTCGGAGGTTGGGGGCTCTGTGGAGGACCTGATTGCCAAAGGCCCCGTCTCAAAGTACTCCCAGGCGGTGCCAGCCGTGACCGAGGGGCCCATTCCCGAGGTGCTCAAGAACTACATGGACGCCCAGTACTACGGGGAGATTGGCATCGGGACGCCCCCCCAGTGCTTCACAGTCGTCTTCGACACGGGCTCCTCCAACCTGTGGGTCCCCTCCATCCACTGCAAACTGCTGGACATCGCTTGCTGGATCCACCACAAGTACAACAGCGACAAGTCCAGCACCTACGTGAAGAATGGTACCTCGTTTGACATCCACTATGGCTCGGGCAGCCTCTCCGGGTACCTGAGCCAGGACACTGTGTCGGTGCCCTGCCAGTCAGCGTCGTCAGCCTCTGCCCTGGGCGGTGTCAAAGTGGAGAGGCAGGTCTTTGGGGAGGCCACCAAGCAGCCAGGCATCACCTTCATCGCAGCCAAGTTCGATGGCATCCTGGGCATGGCCTACCCCCGCATCTCCGTCAACAACGTGCTGCCCGTCTTCGACAACCTGATGCAGCAGAAGCTGGTGGACCAGAACATCTTCTCCTTCTACCTGAGCAGGGACCCAGATGCGCAGCCTGGGGGTGAGCTGATGCTGGGTGGCACAGACTCCAAGTATTACAAGGGTTCTCTGTCCTACCTGAATGTCACCCGCAAGGCCTACTGGCAGGTCCACCTGGACCAGGTGGAGGTGGCCAGCGGGCTGACCCTGTGCAAGGAGGGCTGTGAGGCCATTGTGGACACAGGCACTTCCCTCATGGTGGGCCCGGTGGATGAGGTGCGCGAGCTGCAGAAGGCCATCGGGGCCGTGCCGCTGATTCAGGGCGAGTACATGATCCCCTGTGAGAAGGTGTCCACCCTGCCCGCGATCACACTGAAGCTGGGAGGCAAAGGCTACAAGCTGTCCCCAGAGGACTACACGCTCAAGGTGTCGCAGGCCGGGAAGACCCTCTGCCTGAGCGGCTTCATGGGCATGGACATCCCGCCACCCAGCGGGCCACTCTGGATCCTGGGCGACGTCTTCATCGGCCGCTACTACACTGTGTTTGACCGTGACAACAACAGGGTGGGCTTCGCCGAGGCTGCCCGCCTCTAGTTCCCAAGGCGTCCGCGCGCCAGCACAGAAACAGAGGAGAGTCCCAGAGCAGGAGGCCCCTGGCCCAGCGGCCCCTCCCACACACACCCACACACTCGCCCGCCCACTGTCCTGGGCGCCCTGGAAGCCGGCGGCCCAAGCCCGACTTGCTGTTTTGTTCTGTGGTTTTCCCCTCCCTGGGTTCAGAAATGCTGCCTGCCTGTCTGTCTCTCCATCTGTTTGGTGGGGGTAGAGCTGATCCAGAGCACAGATCTGTTTCGTGCATTGGAAGACCCCACCCAAGCTTGGCAGCCGAGCTCGTGTATCCTGGGGCTCCCTTCATCTCCAGGGAGTCCCCTCCCCGGCCCTACCAGCGCCCGCTGGGCTGAGCCCCTACCCCACACCAGGCCGTCCTCCCGGGCCCTCCCTTGGAAACCTGCCCTGCCTGAGGGCCCCTCTGCCCAGCTTGGGCCCAGCTGGGCTCTGCCACCCTACCTGTTCAGTGTCCCGGGCCCGTTGAGGATGAGGCCGCTAGAGGCCTGAGGATGAGCTGGAAGGAGTGAGAGGGGACAAAACCCACCTTGTTGGAGCCTGCAGGGTGGTGCTGGGACTGAGCCAGTCCCAGGGGCATGTATTGGCCTGGAGGTGGGGTTGGGATTGGGGGCTGGTGCCAGCCTTCCTCTGCAGCTGACCTCTGTTGTCCTCCCCTTGGGCGGCTGAGAGCCCCAGCTGACATGGAAATACAGTTGTTGGCCTCCGGCCTCCCCTC