Transcript asmbl_21639

Sequence
Transcript Sequence for observation asmbl_21639 of TGE0056998:
CAGCCTCGAGCTGCTCACTTGGCTCTCGCCCTCCGGCCGGGAAGCATGGGGCTTCCCAGGCTGGTCTGCGCCTTCTTGCTCGCCGCCTGCTGCTGCTGTCCTCGCGTCGCGGGTGTGCCCGGAGAGGCTGAGCAGCCTGCGCCTGAGCTGGTGGAGGTGGAAGTGGGCAGCACAGCCCTTCTGAAGTGCGGCCTCTCCCAGTCCCAAGGCAACCTCAGCCATGTCGACTGGTTTTCTGTCCACAAGGAGAAGCGGACGCTCATCTTCCGTGTGCGCCAGGGCCAGGGCCAGAGCGAACCTGGGGAGTACGAGCAGCGGCTCAGCCTCCAGGACAGAGGGGCTACTCTGGCCCTGACTCAAGTCACCCCCCAAGACGAGCGCATCTTCTTGTGCCAGGGCAAGCGCCCTCGGTCCCAGGAGTACCGCATCCAGCTCCGCGTCTACAAAGCTCCGGAGGAGCCAAACATCCAGGTCAACCCCCTGGGCATCCCTGTGAACAGTAAGGAGCCTGAGGAGGTCGCTACCTGTGTAGGGAGGAACGGGTACCCCATTCCTCAAGTCATCTGGTACAAGAATGGCCGGCCTCTGAAGGAGGAGAAGAACCGGGTCCACATTCAGTCGTCCCAGACTGTGGAGTCGAGTGGTTTGTACACCTTGCAGAGTATTCTGAAGGCACAGCTGGTTAAAGAAGACAAAGATGCCCAGTTTTACTGTGAGCTCAACTACCGGCTGCCCAGTGGGAACCACATGAAGGAGTCCAGGGAAGTCACCGTCCCTGTTTTCTACCCGACAGAAAAAGTGTGGCTGGAAGTGGAGCCCGTGGGAATGCTGAAGGAAGGGGACCGCGTGGAAATCAGGTGTTTGGCTGATGGCAACCCTCCACCACACTTCAGCATCAGCAAGCAGAACCCCAGCACCAGGGAGGCAGAGGAAGAGACAACCAACGACAACGGGGTCCTGGTGCTGGAGCCTGCCCGGAAGGAACACAGTGGGCGCTATGAATGTCAGGGCCTGGACTTGGACACCATGATATCGCTGCTGAGTGAACCACAGGAACTACTGGTGAACTATGTGTCTGACGTCCGAGTGAGTCCCGCAGCCCCTGAGAGACAGGAAGGCAGCAGCCTCACCCTGACCTGTGAGGCAGAGAGTAGCCAGGACCTCGAGTTCCAGTGGCTGAGAGAAGAGACAGGCCAGGTGCTGGAAAGGGGGCCTGTGCTTCAGTTGCATGACCTGAAACGGGAGGCAGGAGGCGGCTATCGCTGCGTGGCGTCTGTGCCCAGCATACCCGGCCTGAACCGCACACAGCTGGTCAACGTGGCCATTTTTGGCCCCCCTTGGATGGCATTCAAGGAGAGGAAGGTGTGGGTGAAAGAGAATATGGTGTTGAATCTGTCTTGTGAAGCGTCAGGGCACCCCCGGCCCACCATCTCCTGGAACGTCAACGGCACGGCAAGTGAACAAGACCAAGATCCACAGCGAGTCCTGAGCACCCTGAATGTCCTCGTGACCCCGGAGCTGTTGGAGACAGGTGTTGAATGCACGGCCTCCAACGACCTGGGCAAAAACACCAGCATCCTCTTCCTGGAGCTGGTCAATTTAACCACCCTCACACCAGACTCCAACACAACCACTGGCCTCAGCACTTCCACTGCCAGTCCTCATACCAGAGCCAACAGCACCTCCACAGAGAGAAAGCTGCCGGAGCCGGAGAGCCGGGGCGTGGTCATCGTGGCTGTGATTGTGTGCATCCTGGTCCTGGCGGTGCTGGGCGCTGTCCTCTATTTCCTCTATAAGAAGGGCAAGCTGCCGTGCAGGCGCTCAGGGAAGCAGGAGATCACGCTACCCCCGTCTCGTAAGAGCGAACTTGTAGTTGAAGTTAAGTCAGATAAGCTCCCAGAAGAGATGGGCCTCCTGCAGGGCAGCAGCGGTGACAAGAGGGCTCCGGGAGACCAGGGAGAGAAATACATCGATCTGAGGCATTAGCCCCGAATCACTTCAGCTCCCTTCCCTGCCTGGACCATTCCCAGCTCCCTGCTCACTCTTCTCTCAGCCAAAGCCTCCAAAGGGACTAGAGAGAAGCCTCCTGCTCCCCTCGCCTGCACACCCCCTTTCAGAGGGCCACTGGGTTAGGACCTGAGGACCTCACTTGGCCCTGCAAGGCCCGCTTTTCAGGGACCAGTCCACCACCATCTCCTCCACGTTGAGTGAAGCTCATCCCAAGCAAGGAGCCCCAGTCTCCCGAGCGGGTAGGAGAGTTTCTTGCAGAACGTGTTTTTTCTTTACACACATTATGGCTGTAAATACCTGGCTCCTGCCAGCAGCTGAGCTGGGTAGCCTCTCTGAGCTGGTTTCCTGCCCCAAAGGCTGGCTTCCACCATCCAGGTGCACCACTGAAGTGAGGACACACCGGAGCCAGGCGCCTGCTCATGTTGAAGTGCGCTGTTCACACCCGCTCCGGAGAGCACCCCAGCAGCATCCAGAAGCAGCTGCAGTGTTGCTGCCACCACCCTCCTGTCTGCCTCTTCAAAGTCTCCTGTGACATTTTTTCTTTGGTCAGAAGCCAGGAACTGGTGTCATTCCTTAAAAGATACGTGCCGGGGCCAGGTGTGGTGGCTCACGCC