Transcript asmbl_21633

Sequence
Transcript Sequence for observation asmbl_21633 of TGE0056760:
CTGCGGCGGGCGTCTGTTCTAGTGTTTGAGCCGTCGTGCTTCACCGGTCTACCTCGCTAGCATGTCGGGCCGCGGCAAGACTGGCGGCAAGGCCCGCGCCAAGGCCAAGTCGCGCTCGTCGCGCGCCGGCCTCCAGTTCCCAGTGGGCCGTGTACACCGGCTGCTGCGGAAGGGCCACTACGCCGAGCGCGTTGGCGCCGGCGCGCCAGTGTACCTGGCGGCAGTGCTGGAGTACCTCACCGCTGAGATCCTGGAGCTGGCGGGCAATGCGGCCCGCGACAACAAGAAGACGCGAATCATCCCCCGCCACCTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTGGGCGGCGTGACGATCGCCCAGGGAGGCGTCCTGCCCAACATCCAGGCCGTGCTGCTGCCCAAGAAGACCAGCGCCACCGTGGGGCCGAAGGCGCCCTCGGGCGGCAAGAAGGCCACCCAGGCCTCCCAGGAGTACTAAGAGGGCCCGCGCCGCGGCCGGCCGCCAGGCCTCCCCATGCCACCACAAAGGCCCTTTTAAGGGCCACCACCGCCCTCATGGAAAGAGCTGAGCCGCTTCAGACTGCGGGGCAAGCGGGCCGCGGCTCCCTTCCCCTCCCCTCCCCTCGCCCGCCTTCGCCGCCCGGCCTCGAGTCCCCGCCCGCCCCCGCTCCCGTCCCGCACCGCCTGCCGCGTCGGCCTCGGGCCCTGCCCTGTCCGCCGTCCGCCCTCCGGTAGGGTTCGGGCCTTCCGGATGCGGCTTGGGCGCTCTTCGGGGACCTCCGTGGCGCGGAAGACCCGAGCCTGCCGGGGGGAGGCCGGCGGCGCCGCACCTGCCCGCCTCGGCGTTCGTGACTCAGCCGCCCCATCCCGAGTCGCTAAGGGGCTGCGGGGAGGCCGCAGCACCTTCTGGAAGACTTGGCCTTCCGCTCTGACGCAGGGCCGAGGTGGGCAGTCCAGGCCGAGAGGCCGGCGGCCCTGAAGGTCTGCGCTGGGGCCGGGACGAAGCACTTGGTAACAGGCACATCTTCCTCCCGAGTGACTGCCTCCTAGGAGGACATTTAGGGGAGGGCAGAGGCCTGCAGTTTGGCTTCACGGCTGGCTATGTGGACAGCAAGAGTCGTTTTCGCGGAAGCCGACTGGCAGCCAGGCCTGTCGGGCCCCCCGACGCCGCCCCATTTCCCTTCCAGCAAACTCAACTCGGCAATCCAAGCACCTAGATACCAGCACAAGTCGGTTAATCCCTGTCTGGACTGAGCCTCCGTTGGCTTCTGAACTGGAATTCTGCAGCTAACCCTTCCACGACTAGAACCTTAGGCATTGGGGAGTTTTAGATGGACTAATTTTATTAAAGGATT