Transcript asmbl_21628

Sequence
Transcript Sequence for observation asmbl_21628 of TGE0056759:
CCCCGTGCAGCCACCTGCTGCACTTGCGCACTGGGAGCGACACGCTCGGGCATAAGTAGTGCCGGAAAGTTAGCTGCCGAGACCTGGTGGATTGCTTTTCGTTTATCAGTGCAGGAAAACAGCGCTATAGTATGCGTCACAACTAGCGCAGACTCCGGCAGTATTTAGGCGGTGCGGCTTGGGAACTAGAATCCACTTCCTGTCTTCCGCCTCAGGCTAGAGGGCGAGCGCTTCGCCGTGGGACTTCTTCTGCCTGGCTCCGCCTTTTGCCCCGGAAGTACTCACAGCGGACGGTGGTTTTTGGGCCCGTTTCTGAGCAGCGCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCAATGCCGCCTAAGGACGACAAGAAGAAGAAGGACGCTGGAAAGTCGGCCAAGAAAGACAAAGACCCAGTGAACAAATCCGGGGGCAAGGCCAAAAAGAAGGTAGAAATAAGACCTCTCTGAAAGAGACTAGGGGTAACTCTCTCGTAATCCTCTAGTAATAGGTAACTTGTATAGTAAGTGGTTTTTCAGGTGTAGATTTCTAGAGTCAAAATGTGAGAGTTTATCTTCCCGTCACCACTCGTTCTTTTTCCCATTAGGATCATGAAAATGGGTCTGTTGTGCGAAGTGTCTGCCGCTGTGCCTGCTGTGTTATTTTTAACTGATCTAGTGGGGCTCGGCCCCTGTTTGAAGGCCAAAAACGTGTCGGTGTTTTTTTTTTGTTTTTGTTTTAGTAATGTGTAATTTATCCTTGATAACGGTGGAACAGATTTCTCTGACGCAGATTACTCGAGAGGGAAAGGGTGCTTCTGCCAGAAATACTAACTTGTTTCTGTTTTGTTTTGGTGAGCAGAAGTGGTCCAAAGGCAAAGTTCGGGACAAGCTCAATAACTTAGTCTTGTTTGACAAAGCTACCTATGATAAACTCTGTAAGGAAGTTCCCAACTATAAACTTATAACCCCAGCTGTGGTCTCTGAGAGACTGAAGATTCGAGGCTCCCTGGCCAGGGCAGCCCTTCAGGAGCTCCTTAGTAAAGGACTTATCAAACTGGTTTCAAAGCACAGAGCTCAAGTAATTTACACCAGAAATACCAAGGGTGGAGATGCTCCAGCTGCTGGTGAAGATGCATGAATAGGTCCAACCAGCTGTACATTTGGAAAAATAAAACTTTATTAAATCAAA