Transcript asmbl_20933

Sequence
Transcript Sequence for observation asmbl_20933 of TGE0056994:
AAGTTCAGCATGCCTGGCTTCAAAGCAGAGGGCCCTGAAGTAGACGTCAACTTGCCTAAGGCTGACGTTGACATCTCAGGACCCAAGGTGGACATTGAAGGCCCTGATGTTAATATTGAAGGACCAGAGGGAAAGTTGAAAGGGCCTAAGTTAAAGATGCCAGAGATGAACATCAAACCCCCAAGATCTCCATGCCTGATATTGACTTAAACCTGAAAGGACCCAAAGTGAAGGGTGATGTGGATGTTT