Transcript asmbl_15780

Sequence
Transcript Sequence for observation asmbl_15780 of TGE0056755:
CCGAGGGAAGCCCCGACTCCGTAGTCGCTGCACAGTCTGTCTCTTCGCCGGTTCCCGGCCCCGTGGATCCTACTTCTCTGTCGCCCGCGGTTCGCCGCCCCGCTCGCCGCCGCGATGCCAGTGTTTCATACGCGCACGATCGAGAGCATCCTGGAGCCGGTGGCACAGCAGATCTCCCACCTGGTGATAATGCACGAGGAGGGCGAGGTGGACGGCAAAGCCATTCCTGACCTCACCGCGCCCGTGGCCGCCGTGCAGGCGGCCGTCAGCAACCTCGTCCGGGTTGGAAAAGAGACTGTTCAAACCACTGAGGATCAGATTTTGAAGAGAGATATGCCACCAGCATTTATTAAGGTTGAGAATGCTTGCACCAAGCTTGTCCAGGCAGCTCAGATGCTTCAGTCAGACCCTTACTCAGTGCCTGCTCGAGATTATCTAATTGATGGGTCAAGGGGCATCCTCTCTGGAACATCAGACCTGCTCCTTACCTTCGATGAGGCTGAGGTCCGTAAAATTATTAGAGTTTGCAAAGGAATTTTGGAATATCTTACAGTGGCAGAGGTGGTGGAGACTATGGAAGATTTGGTCACTTACACAAAGAATCTTGGGCCAGGAATGACTAAGATGGCCAAGATGATTGACGAGAGACAGCAGGAGCTCACTCACCAGGAGCACCGAGTGATGTTGGTGAACTCGATGAACACCGTGAAAGAGTTGCTGCCAGTTCTCATTTCAGCTATGAAGATTTTTGTAACAACTAAAAACTCAAAAAACCAAGGCATAGAGGAAGCTTTAAAAAATCGCAATTTTACTGTAGAAAAAATGAGTGCTGAAATTAATGAGATAATTCGTGTGTTACAACTCACCTCTTGGGATGAAGATGCCTGGGCCAGCAAGGACACTGAAGCCATGAAGAGAGCATTGGCCTCCATAGACTCCAAACTGAACCAGGCCAAAGGTTGGCTCCGTGACCCTAGTGCCTCCCCAGGGGATGCTGGTGAGCAGGCCATCAGACAGATCTTAGATGAAGCTGGAAAAGTTGGTGAACTCTGTGCAGGCAAAGAACGCAGGGAGATTCTGGGAACTTGCAAAATGCTAGGGCAGATGACTGATCAAGTGGCTGACCTCCGTGCCAGAGGACAAGGATCCTCACCGGTGGCCATGCAGAAAGCTCAGCAGGTATCTCAGGGTCTGGATGTGCTCACAGCAAAAGTGGAAAATGCAGCTCGCAAGCTGGAAGCCATGACCAACTCAAAGCAGAGCATTGCAAAGAAGATCGATGCTGCTCAGAACTGGCTTGCAGATCCAAATGGTGGACCGGAAGGAGAAGAGCAGATTCGAGGTGCTTTGGCTGAAGCTCGGAAAATAGCAGAATTATGTGATGATCCTAAAGAAAGAGATGACATTCTACGTTCCCTTGGGGAAATATCTGCTCTGACTTCTAAATTAGCAGATCTACGAAGACAGGGGAAAGGAGATTCTCCAGAGGCTCGAGCCTTGGCCAAACAGGTGGCCACGGCCCTGCAGAACCTGCAGACCAAAACCAACCGGGCTGTGGCCAACAGCAGACCGGCCAAAGCAGCTGTACACCTTGAGGGCAAGATTGAGCAAGCACAGCGGTGGATTGATAATCCCACAGTGGATGACCGTGGAGTCGGTCAGGCTGCCATCCGGGGGCTTGTGGCCGAAGGGCATCGTCTGGCTAATGTTATGATGGGGCCTTATCGGCAAGATCTTCTCGCCAAGTGTGACCGAGTGGACCAGCTGACAGCCCAGCTGGCTGACCTGGCTGCCAGAGGGGAAGGGGAGAGTCCTCAGGCACGAGCACTTGCATCTCAGCTCCAAGACTCCTTAAAGGATCTAAAAGCTCGGATGCAGGAGGCCATGACTCAGGAAGTGTCAGATGTTTTCAGCGATACCACAACTCCCATCAAGCTGTTGGCAGTGGCAGCCACGGCGCCTCCTGATGCGCCTAACAGGGAAGAGGTATTTGATGAGAGGGCAGCTAACTTTGAAAACCATTCAGGAAAGCTTGGTGCTACGGCCGAGAAGGCGGCTGCGGTTGGTACTGCTAATAAATCAACAGTGGAAGGCATTCAGGCCTCAGTGAAGACGGCCCGAGAACTCACACCCCAGGTGGTCTCGGCTGCTCGTATCTTACTTAGGAACCCTGGAAATCAAGCTGCTTATGAACATTTTGAGACCATGAAGAACCAGTGGATCGATAATGTTGAAAAAATGACAGGGCTGGTGGACGAAGCCATTGATACCAAATCTCTGTTGGATGCTTCAGAAGAAGCAATTAAAAAAGACCTGGACAAGTGCAAGGTAGCTATGGCCAACATTCAGCCTCAGATGCTGGTTGCTGGGGCAACCAGTATTGCTCGTCGGGCCAACCGGATCCTGCTGGTGGCTAAGAGGGAGGTGGAGAATTCCGAGGATCCCAAGTTCCGTGAGGCTGTGAAAGCTGCCTCTGATGAATTGAGCAAAACCATCTCCCCGATGGTGATGGATGCAAAAGCTGTGGCTGGAAACATTTCCGACCCTGGACTGCAAAAGAGCTTCCTGGACTCAGGATATCGGATCCTGGGAGCTGTGGCCAAGGTCAGAGAAGCCTTCCAACCTCAGGAGCCTGACTTCCCGCCGCCTCCACCAGACCTTGAACAACTCCGACTAACAGATGAGCTTGCTCCTCCCAAACCACCTCTGCCTGAAGGTGAGGTCCCTCCACCTAGGCCTCCACCACCAGAGGAAAAGGATGAAGAGTTCCCTGAGCAGAAGGCCGGGGAGGTGATTAACCAGCCAATGATGATGGCTGCCAGACAGCTCCATGATGAAGCTCGCAAATGGTCCAGCAAGGGCAATGACATCATTGCAGCAGCCAAGCGCATGGCTCTGCTGATGGCTGAGATGTCTCGGCTGGTAAGAGGGGGCAGTGGTACCAAGCGGGCACTCATTCAGTGTGCCAAGGACATCGCCAAGGCCTCAGATGAGGTGACTCGGTTGGCCAAGGAGGTTGCCAAGCAGTGCACAGATAAACGGATTAGAACCAACCTCTTACAGGTATGTGAGCGAATCCCAACCATAAGCACCCAGCTCAAAATCCTGTCCACAGTGAAGGCCACCATGCTGGGCCGGACCAACATCAGTGATGAGGAGTCTGAGCAGGCCACAGAGATGCTGGTTCACAATGCCCAGAACCTCATGCAGTCTGTGAAGGAGACTGTGCGGGAAGCTGAAGCTGCTTCAATCAAAATTCGAACAGATGCTGGATTTACACTGCGCTGGGTTAGAAAGACTCCCTGGTACCAGTAGGCACCTGGCTGAGCCTGGCTGGCACAGAAACCTCTACTAAAAAGAAGGAAAATGATCTGAGTCCCAGGAGCTGCCCAGAGTTGCTGGGAGCTGAAAAATCACATCCTGGCCTGGCACATCAGAAAGGAATGGGGGCCTCTTCAAATTAGAAGACATTTATACTCTTTTTTCATGGACACTTTGAAATGTGTTTCTGTATAAAGCCTGTATTCTCAAACACAGTTACACTTGTGCACCCTCTATCCCAATAGGCAGACTGGGTTTCTAGCCCATGGACTTCACATAAGCTCAGAATCCAAGTGAACACTAGCCAGACACTCTGCTCTGCCCTTGTTCCCTAGGGGACACTTCCCTCTGTTTCTCTTTCCTTGGCTCCCATTCACTCTTCCAGAATCCCAAGACCCAGGGCCCAGGCAAATCAGTTACTAAGAAGAAAATTGCTGTGCCTCCCAAAATTGTTTTGAGCTTTCCATGTTGCTGCCAACCATACCTTCCTTCCCTGGGCTGTGCTACCTGGGTCCTTTTCAGAAGTGAGCTTTGCTGCTACAGGGGAAGGTGGCCTCTGTGGAGCCCCAGCATATGGGGGCCTGGATTCATTTCCTGCCCTTCCTCAGTTTAATCCTTCTAGTTTCCCACAATATAAAACTGTACTTCACTGTCAGGAAGAAATCACAGAATCATATGATTCTGCTTTTACCATGCCCCTGAGCAATGTCTGTGCTAGGGAAACTTCCCGTCCCATATCCTGCCTCAGCCCGCCAAGGTAGCCATCCCATGAACACACTGTGTCCTGGTGCTCTCTGCCACTGGAAGGGCAGAGTAGCCAGGGTGTGGCCCTGCCATCTTCCCAGCAGGGCCACTCCCGGCACTCCATGCTTAGTCACTGCCTGCAGAGGTCTGTGCTGAGGCCTTATCATTCATTCTTAGCTCTTAATTGTTCATTTTGAGCTGAAATGCTGCATTTTAATTTTAACCAAAACATGTCTCCTATCCTGGTTTTTGTAGCCTTCCTCCACATCCTTTCTAAACAAGATTTTAAAGACATGTAGGTGTTTGTTCATCTGTAACTCTAAAAGATCCTTTTTAAATTCAGTCCTAAGAAAGAGGAGTGCTTGTCCCCTAAGAGTGTTTAATGGCAAGGCAGCCCTGTCTGAAGGACACTTCCTGCCTAAGGGAGAGTGGTATTTGCAGACTAGAATTCTAGTGCTGCTGAAGATGAATCAATGGGAAATACTACTCCTGTAATTCCTACCTCCCTGCAACCAACTACAACCAAGCTCTCTGCATCTACTCCCAAGTATGGGGTTCAAGAGAGTAATGGGTTTCATATTTCTTATCACCACAGTAAGTTCCTACTAGGCAAAATGAGAGGGCAGTGTTTCCTTTTTGGTACTTATTACTGCTAAGTATTTCCCAGCACATGAAACCTTATTTTTTCCCAAAGCCAGAACCAGATGAGTAAAGGAGTAAGAACCTTGCCTGAACATCCTTCCTTCCCACCCATCGCTGTGTGTTAGTTCCCAACATCGAATGTGTACAACTTAAGTTGGTCCTTTACACTCAGGCTTTCACTATTTCCTTTATAATGAGGATGATTATTTTCAAGGCCCTCAGCATATTTGTATAGTTGCTTGCCTGATATAAATGCAATATTAATGCCTTTAAAGTATGAATCTATGCCAAAGATCACTTGTTGTTTTACTAAAGAAAGATTACTTAGAGGAAATAAGAAAAATCATGTTTGCTCTCCCGGTTCTTCCAGTGGTTTGAGACACTGGTTTACACTTTATGCCGGATGTGCTTTTCTCCAATATCAGTGCTCGAGACACAGTGAAGCAAATT