Transcript asmbl_15779

Sequence
Transcript Sequence for observation asmbl_15779 of TGE0056993:
CCGAGGGAAGCCCCGACTCCGTAGTCGCTGCACAGTCTGTCTCTTCGCCGGTTCCCGGCCCCGTGGATCCTACTTCTCTGTCGCCCGCGGTTCGCCGCCCCGCTCGCCGCCGCGATGCCAGTGTTTCATACGCGCACGATCGAGAGCATCCTGGAGCCGGTGGCACAGCAGATCTCCCACCTGGTGATAATGCACGAGGAGGGCGAGGTGGACGGCAAAGCCATTCCTGACCTCACCGCGCCCGTGGCCGCCGTGCAGGCGGCCGTCAGCAACCTCGTCCGGGTTGGAAAAGAGACTGTTCAAACCACTGAGGATCAGATTTTGAAGAGAGATATGCCACCAGCATTTATTAAGGTTGAGAATGCTTGCACCAAGCTTGTCCAGGCAGCTCAGATGCTTCAGTCAGACCCTTACTCAGTGCCTGCTCGAGATTATCTAATTGATGGGTCAAGGGGCATCCTCTCTGGAACATCAGACCTGCTCCTTACCTTCGATGAGGCTGAGGTCCGTAAAATTATTAGAGTTTGCAAAGGAATTTTGGAATATCTTACAGTGGCAGAGGTGGTGGAGACTATGGAAGATTTGGTCACTTACACAAAGAATCTTGGGCCAGGAATGACTAAGATGGCCAAGATGATTGACGAGAGACAGCAGGAGCTCACTCACCAGGAGCACCGAGTGATGTTGGTGAACTCGATGAACACCGTGAAAGAGTTGCTGCCAGTTCTCATTTCAGCTATGAAGATTTTTGTAACAACTAAAAACTCAAAAAACCAAGGCATAGAGGAAGCTTTAAAAAATCGCAATTTTACTGTAGAAAAAATGAGTGCTGAAATTAATGAGATAATTCGTGTGTTACAACTCACCTCTTGGGATGAAGATGCCTGGGCCAGCAAGGACACTGAAGCCATGAAGAGAGCATTGGCCTCCATAGACTCCAAACTGAACCAGGCCAAAGGTTGGCTCCGTGACCCTAGTGCCTCCCCAGGGGATGCTGGTGAGCAGGCCATCAGACAGATCTTAGATGAAGCTGGAAAAGTTGGTGAACTCTGTGCAGGCAAAGAACGCAGGGAGATTCTGGGAACTTGCAAAATGCTAGGGCAGATGACTGATCAAGTGGCTGACCTCCGTGCCAGAGGACAAGGATCCTCACCGGTGGCCATGCAGAAAGCTCAGCAGGTATCTCAGGGTCTGGATGTGCTCACAGCAAAAGTGGAAAATGCAGCTCGCAAGCTGGAAGCCATGACCAACTCAAAGCAGAGCATTGCAAAGAAGATCGATGCTGCTCAGAACTGGCTTGCAGATCCAAATGGTGGACCGGAAGGAGAAGAGCAGATTCGAGGTGCTTTGGCTGAAGCTCGGAAAATAGCAGAATTATGTGATGATCCTAAAGAAAGAGATGACATTCTACGTTCCCTTGGGGAAATATCTGCTCTGACTTCTAAATTAGCAGATCTACGAAGACAGGGGAAAGGAGATTCTCCAGAGGCTCGAGCCTTGGCCAAACAGGTGGCCACGGCCCTGCAGAACCTGCAGACCAAAACCAACCGGGCTGTGGCCAACAGCAGACCGGCCAAAGCAGCTGTACACCTTGAGGGCAAGATTGAGCAAGCACAGCGGTGGATTGATAATCCCACAGTGGATGACCGTGGAGTCGGTCAGGCTGCCATCCGGGGGCTTGTGGCCGAAGGGCATCGTCTGGCTAATGTTATGATGGGGCCTTATCGGCAAGATCTTCTCGCCAAGTGTGACCGAGTGGACCAGCTGACAGCCCAGCTGGCTGACCTGGCTGCCAGAGGGGAAGGGGAGAGTCCTCAGGCACGAGCACTTGCATCTCAGCTCCAAGACTCCTTAAAGGATCTAAAAGCTCGGATGCAGGAGGCCATGACTCAGGAAGTGTCAGATGTTTTCAGCGATACCACAACTCCCATCAAGCTGTTGGCAGTGGCAGCCACGGCGCCTCCTGATGCGCCTAACAGGGAAGAGGTATTTGATGAGAGGGCAGCTAACTTTGAAAACCATTCAGGAAAGCTTGGTGCTACGGCCGAGAAGGCGGCTGCGGTTGGTACTGCTAATAAATCAACAGTGGAAGGCATTCAGGCCTCAGTGAAGACGGCCCGAGAACTCACACCCCAGGTGGTCTCGGCTGCTCGTATCTTACTTAGGAACCCTGGAAATCAAGCTGCTTATGAACATTTTGAGACCATGAAGAACCAGTGGATCGATAATGTTGAAAAAATGACAGGGCTGGTGGACGAAGCCATTGATACCAAATCTCTGTTGGATGCTTCAGAAGAAGCAATTAAAAAAGACCTGGACAAGTGCAAGGTAGCTATGGCCAACATTCAGCCTCAGATGCTGGTTGCTGGGGCAACCAGTATTGCTCGTCGGGCCAACCGGATCCTGCTGGTGGCTAAGAGGGAGGTGGAGAATTCCGAGGATCCCAAGTTCCGTGAGGCTGTGAAAGCTGCCTCTGATGAATTGAGCAAAACCATCTCCCCGATGGTGATGGATGCAAAAGCTGTGGCTGGAAACATTTCCGACCCTGGACTGCAAAAGAGCTTCCTGGACTCAGGATATCGGATCCTGGGAGCTGTGGCCAAGGTCAGAGAAGCCTTCCAACCTCAGGAGCCTGACTTCCCGCCGCCTCCACCAGACCTTGAACAACTCCGACTAACAGATGAGCTTGCTCCTCCCAAACCACCTCTGCCTGAAGGTGAGGTCCCTCCACCTAGGCCTCCACCACCAGAGGAAAAGGATGAAGAGTTCCCTGAGCAGAAGGCCGGGGAGGTGATTAACCAGCCAATGATGATGGCTGCCAGACAGCTCCATGATGAAGCTCGCAAATGGTCCAGCAAGGTAAGTAGTGAAGCTTTTCTTGTTGAGAAAGGATGTCTTCTCGGAAAGGATGAAGGACCATGAAAGACCCAGAAAGAAGAGTCTATTTGGAGTCACCCTCTCTCTCTCCTTTGGTTCCTGTGTTGCCAATAGCATATTCCTCTTCTTACCTGTGCTTTAGTGAGATGTTTCTGACACCTGATGGTTTCTCCTTCAAGCTTGCAAAAGCCAGAGTCAGGGTGCCTGTGATTTGAGAAGAGGATTCCTGTCCTTTGTCCATTAGAGTGCCAGGTGCCTTGACCTTAGCATTTGGGGTCTTTTAGAAATTGCTTATCTTTCTTGGAACTGCAAATGTTTTTAGATGCTACATTGCTAATGATCAGAGCTCCAAATATGAATTGTGTGGGCTGTGCTAA