Transcript asmbl_15464

Sequence
Transcript Sequence for observation asmbl_15464 of TGE0056991:
CTTGCTAACAAAAAGTCCGCACATTCGAGCAAAGACAGGCTTTAGCGAGTTATTAAAAACTTAGGGGCGCTCTTGTCCCCCACAGGGCCCGACCGCACACAGCAAGGCGATGGCCCAGCTGTAAGTTGGTAGCACTGAGAACTAGCAGCGCGCGCGGAGCCCGCTGAGACTTGAATCAATCTGGTCTAACGGTTTCCCCTAAACCGCTAGGAGCCCTCAATCGGCGGGACAGCAGGGCGCGGTGAGTCACCGCCGGTGACTAAGCGACCCCACCCCTCTCCCTCGGGCTTTCCTCTGCCACCGCCGTCTCGCAACTCCCGCCGTCCGAAGCTGGACTGAGCCCGTTAGGTCCCTCGACAGAACCTCCCCTCCCCCCAACATCTCTCCGCCAAGTCCTCTGCCACTCTCGCTCCGAGGTCCCCGCGCCAGAGACGCAGCCGCGCTCCCACCACCCACACCCACCGCGCCCTCGTTCGCCTCTTCTCCGGGAGCCAGTCCGCGCCACCGCCGCCGCCCAGGCCATCGCCACCCTCCGCAGCCATGTCCACCAGGTCCGTGTCCTCGTCCTCCTACCGCAGGATGTTCGGCGGCCCGGGCACCGCGAGCCGGCCGAGCTCCAGCCGGAGCTACGTGACTACGTCCACCCGCACCTACAGCCTGGGCAGCGCGCTGCGCCCCAGCACCAGCCGCAGCCTCTACGCCTCGTCCCCGGGCGGCGTGTATGCCACGCGCTCCTCTGCCGTGCGCCTGCGGAGCAGCGTGCCCGGGGTGCGGCTCCTGCAGGACTCGGTGGACTTCTCGCTGGCCGACGCCATCAACACCGAGTTCAAGAACACCCGCACCAACGAGAAGGTGGAGCTGCAGGAGCTGAATGACCGCTTCGCCAACTACATCGACAAGGTGCGCTTCCTGGAGCAGCAGAATAAGATCCTGCTGGCCGAGCTCGAGCAGCTCAAGGGCCAAGGCAAGTCGCGCCTGGGGGACCTCTACGAGGAGGAGATGCGGGAGCTGCGCCGGCAGGTGGACCAGCTAACCAACGACAAAGCCCGCGTCGAGGTGGAGCGCGACAACCTGGCCGAGGACATCATGCGCCTCCGGGAGAAATTGCAGGAGGAGATGCTTCAGAGAGAGGAAGCCGAAAACACCCTGCAATCTTTCAGACAGGATGTTGACAATGCGTCTCTGGCACGTCTTGACCTTGAACGCAAAGTGGAATCTTTGCAAGAAGAGATTGCCTTTTTGAAGAAACTCCACGAAGAGGAAATCCAGGAGCTGCAGGCTCAGATTCAGGAACAGCATGTCCAAATCGATGTGGATGTTTCCAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAATATGAAAGTGTGGCTGCCAAGAACCTGCAGGAGGCAGAAGAATGGTACAAATCCAAGTTTGCTGACCTCTCTGAGGCTGCCAACCGGAACAATGACGCCCTGCGCCAGGCAAAGCAGGAGTCCACTGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGATGCCCTTAAAGGAACCAATGAGTCCCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCCGTTGAAGCTGCTAACTACCAAGACACTATTGGCCGCCTGCAGGATGAGATTCAGAATATGAAGGAGGAAATGGCTCGTCACCTTCGTGAATACCAAGACCTGCTCAATGTTAAGATGGCCCTTGACATTGAGATTGCCACCTACAGGAAGCTGCTGGAAGGCGAGGAGAGCAGGTAGGGAACTCAGACTTGGATGCGTGAACTAATGGTGACCATTTGTTAGGCCCTGTGCCACTGGGCTCTAAGCAGTGTCACATTTAATCTTTAGAAAGTTTCTTTGAGGTAACTGCTTTCCACTTTTTGTAGAGGAGGAATTTGAATTGAGAGAGAGTAAGTGACTTGCTGAAAAAGGGTTAATCAACAGCAGAGCTGGGATTTGAACCCATAACTCTGTCAAAGCCTCCACTCCTAACTCCTGTTCATGCTCCTGTGGAGAAAATGCTTGTAGTAACATATTTTAAATGTACTAACAAGACCAGTCATGGGAAAATGTTTCTGAGACAAATCTCTAGTTTATGATTTAAAACAGTACGTTTTCTTACGTGACGAAAACAAAAAGTGTGTTAATTTGTTCCCAGTGGTTGAAGTTATTTGCCAACAATTTTACTGTTTCTCTTCATCTGTTTATAGGATTTCTCTGCCTCTTCCAAACTTTTCCTCCCTGAACCTGAGGGGTAAGCATTTTATTTCCCTTTAGGAAAAACGTCAGCTGCTTGTAACCACTGTGTTTATGTCAAAGCATTCATTTTTTTTAGGATATCTGAAAAAATGCCATATAAGAGAAAACTCTATAAAACATCTATAATTTTCGAACCCAAGTACACTCTTGCATTCTATGCTTTAAGTTAAATGCAAACTCCTTTTTCCTTCTTCCTGCTGCAAGTACTATCTCATCCTGATGCTCAAGAGTGTCAGGGCCTGGGTTTCCAAACAGAGACTACCCTAAAATTATTTGGCGAGTAGTACTTTACACAATTGCCTCTCCCCCACAAATCATAATTGTTTCAGTAAAATGGTTACTTGGTTTTTCCAAGAAAAAACTCGTTTTTACTCATTTTTGGCCTGTTTGTTTATTTAGAAACTAATCTGGATTCACTCCCTCTGGTTGATACCCACTCAAAAAGGACACTTCTGATTAAGACGGTTGAAACTAGAGATGGACAGGTTATCAACGAAACTTCTCAGCATCACGATGACCTTGAATAAAAATTGCACACACTCAGTGCAGCAATATATTACCAGCAAGAATAAAAAAGAAATCCATATCTTAAAGAAACAGCTTTCAAGTGCCTTTCTGCAGTTTTTCAGGAGCGCAAGATAGATTTGGAATAGGAATAAGCTCTAGTTCTTAACAACCGACACTCCTACAAGATTTAGAAAAAAGTTTACAACATAATCTAGTTTACAGAAAAATCTTGTGCTAGAATACTTTTTAAAAGGTATTTTGAATACCATTAAAACTGCTTTTTTTTTTCCAGCAAGTATCCAACCAACTTGGTTCTGCTTCAATAAATCTTTGGAAAAACTCT