Transcript asmbl_14924

Sequence
Transcript Sequence for observation asmbl_14924 of TGE0056990:
CGCGGGGCGGCGCGCACTCACCCACCCGCGCCGGAGCGGACCTTTGGCTTGGCTTGTCAGGGCTTGTCCAGGAGTTCCGCTCCTCTCTCCAACCGGGGTCCCCCTCCAGCGACCCTAAAGCTTCCCAGACTTCCGCTTCAATTCCTGTCCGCACCCCACGCCCACCTCAACGTGGAGCGCAGTGGTCTCCGAGGAGCGCCGGAGCTGCCCCGCCTGCCCAGCGGGGTCAGCACTTCGCATCAAGGCCCAAGAAAAGCAAGTCCTCCAGCGTTCTGAGCACCCGGGCCTGAGGGAAGGTCCTAACAGCCCCCGGGAGCCAGTCTCCAACGCCTCCCGCAGCAGCCCGCCGCTCCCAGAATCCTGTGAAGCAGCTCCAGCTATGTGTGAAGAAGAGGACAGCACTGCCTTGGTGTGTGACAATGGCTCTGGGCTCTGTAAGGCCGGCTTTGCTGGGGACGATGCTCCCAGGGCTGTTTTCCCATCCATTGTGGGACGTCCCAGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCACAGAGCAAAAGAGGAATCCTGACCCTGAAGTACCCGATAGAACATGGCATCATCACCAACTGGGACGACATGGAAA