Transcript asmbl_14922

Sequence
Transcript Sequence for observation asmbl_14922 of TGE0056751:
GAGAGTTTTGTGCTGAGGTCCCTATATGGTTGTGTTAGACTGAACGACAGGCTCAAGTCTGTCTTTGCTCCTTGTTTGGGAAGCAAGTGGGAGGAGAGCAGGCCAAGGGGCTATATAACCCTTCAGCTTTCAGCTTCCCTGAACACCACCCAGTGTGGAGCAGCCCAGCCAAGCACTGTCAGGAATCCTGTGAAGCAGCTCCAGCTATGTGTGAAGAAGAGGACAGCACTGCCTTGGTGTGTGACAATGGCTCTGGGCTCTGTAAGGCCGGCTTTGCTGGGGACGATGCTCCCAGGGCTGTTTTCCCATCCATTGTGGGACGTCCCAGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCACAGAGCAAAAGAGGAATCCTGACCCTGAAGTACCCGATAGAACATGGCATCATCACCAACTGGGACGACATGGAAAAGATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCCTGAAGAGCATCCCACCCTGCTCACGGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAAAATGACTCAAATTATGTTTGAGACTTTCAATGTCCCAGCCATGTATGTGGCTATCCAGGCGGTGCTGTCTCTCTATGCCTCTGGACGCACAACTGGCATCGTGCTGGACTCTGGAGATGGTGTCACCCACAATGTCCCCATCTATGAGGGCTATGCCTTGCCCCATGCCATCATGCGTCTGGATCTGGCTGGCCGAGATCTCACTGACTACCTCATGAAGATCCTGACTGAGCGTGGCTATTCCTTCGTTACTACTGCTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCTCTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAGAGTTACGAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGACCCTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTGGCATCCATGAAACCACCTACAACAGCATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTCCTATCAGGGGGCACCACTATGTACCCTGGCATTGCCGACCGAATGCAGAAGGAGATCACGGCCCTAGCACCCAGCACCATGAAGATCAAG