Transcript asmbl_14921

Sequence
Transcript Sequence for observation asmbl_14921 of TGE0056751:
CGCGGGGCGGCGCGCACTCACCCACCCGCGCCGGAGCGGACCTTTGGCTTGGCTTGTCAGGGCTTGTCCAGGAGTTCCGCTCCTCTCTCCAACCGGGGTCCCCCTCCAGCGACCCTAAAGCTTCCCAGACTTCCGCTTCAATTCCTGTCCGCACCCCACGCCCACCTCAACGTGGAGCGCAGTGGTCTCCGAGGAGCGCCGGAGCTGCCCCGCCTGCCCAGCGGGGTCAGCACTTCGCATCAAGGCCCAAGAAAAGCAAGTCCTCCAGCGTTCTGAGCACCCGGGCCTGAGGGAAGGTCCTAACAGCCCCCGGGAGCCAGTCTCCAACGCCTCCCGCAGCAGCCCGCCGCTCCCAGGTGCCCGCGTGCGCCGCTGCCGCCGCAATCCCGCACGCGTCCCGCGCCCGCCCCACTTTGCCTATCCCCGGGACTAAGACGGGAATCCTGTGAAGCAGCTCCAGCTATGTGTGAAGAAGAGGACAGCACTGCCTTGGTGTGTGACAATGGCTCTGGGCTCTGTAAGGCCGGCTTTGCTGGGGACGATGCTCCCAGGGCTGTTTTCCCATCCATTGTGGGACGTCCCAGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCACAGAGCAAAAGAGGAATCCTGACCCTGAAGTACCCGATAGAACATGGCATCATCACCAACTGGGACGACATGGAAAAGATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCCTGAAGAGCATCCCACCCTGCTCACGGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAAAATGACTCAAATTATGTTTGAGACTTTCAATGTCCCAGCCATGTATGTGGCTATCCAGGCGGTGCTGTCTCTCTATGCCTCTGGACGCACAACTGGCATCGTGCTGGACTCTGGAGATGGTGTCACCCACAATGTCCCCATCTATGAGGGCTATGCCTTGCCCCATGCCATCATGCGTCTGGATCTGGCTGGCCGAGATCTCACTGACTACCTCATGAAGATCCTGACTGAGCGTGGCTATTCCTTCGTTACTACTGCTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCTCTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAGAGTTACGAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGACCCTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTGGCATCCATGAAACCACCTACAACAGCATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTCCTATCAGGGGGCACCACTATGTACCCTGGCATTGCCGACCGAATGCAGAAGGAGATCACGGCCCTAGCACCCAGCACCATGAAGATCAAG