Transcript asmbl_14920

Sequence
Transcript Sequence for observation asmbl_14920 of TGE0056989:
GAAACCTTCTGGACTAGGCCTGGTCCTGAGACAGCACCACCTCTTTCCTGGAGGGTGAGAAATGTGCCAAAGGTTTAACCTGCTATCCACTGGCCCAGGCAACAGGATCTCAGACTTTTTGAAAATTGTGAGGCCCCTGAGGAGCTGATTCAGCATAAGATATCCTGGTTAACTGAAAATACAATATAACAAACTTTCTGTCATAAAATAATTATAACACAGAGTAGTTATCCTGCCCACCCACCCCAAAAAATGTTATGGTACAAAAGGATCCGCTACTGTGTGCCTTTCTCTAGCTAGCTCATTTTATTCTTGTTATGCATTTCCCAGACAATGCATGCTGAGGGCCTACTATGCATGAGACACTGTCCTAGGAACAGAGGTGGTTCCCTGGTGGCCCTACTACGTCATTATCATTGTGGATTTTGGATTGCAGAATATTGAACTGACACATTTTTTGATGGCACATGTCTTGAGGGAGAGACTGCAGTAGGGCAGGTGAATCTTTGCCACCTGTGCAGACCCTAATGTTTGCCACAATGTTTGTATCTGGTTGACAGCTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCTCTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAGAGTTACGAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGACCCTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTGGCATCCATGAAACCACCTACAACAGCATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTCCTATCAGGGGGCACCACTATGTACCCTGGCATTGCCGACCGAATGCAGAAGGAGATCACGGCCCTAGCACCCAGCACCATGAAGATCAAG