Transcript asmbl_143474

Sequence
Transcript Sequence for observation asmbl_143474 of TGE0056129:
CCCCGCTGTCCCCTCCCCGTCGGCCCGCCTGCCCAGCCTTTAGCCTCCCGCCCGCCGCCTCTGTCTCCCTCTCTCCACAAACTGCCCAGGAGTGAGTAGCTGCTTTCGGTCCGCCGGACACACCGGACAGATAGACGTGCGGACGGCCCACCACCCCAGCCCGCCAACTAGTCAGCCTGCGCCTGGCGCCTCCCCTCTCCAGGTCCATCCGCCATGTGGCCCCTGTGGCGCCTCGTGTCTCTGCTGGCCCTGAGCCAGGCCCTGCCCTTTGAGCAGAGAGGCTTCTGGGACTTCACCCTGGACGATGGGCCATTCATGATGAACGATGAGGAAGCTTCGGGCGCTGACACCTCGGGCGTCCTGGACCCGGACTCTGTCACACCCACCTACAGCGCCATGTGTCCTTTCGGCTGCCACTGCCACCTGCGGGTGGTTCAGTGCTCCGACCTGGGTCTGAAGTCTGTGCCCAAAGAGATCTCCCCTGACACCACGCTGCTGGACCTGCAGAACAACGACATCTCCGAGCTCCGCAAGGATGACTTCAAGGGTCTCCAGCACCTCTACGCCCTCGTCCTGGTGAACAACAAGATCTCCAAGATCCATGAGAAGGCCTTCAGCCCACTGCGGAAGCTGCAGAAGCTCTACATCTCCAAGAACCACCTGGTGGAGATCCCGCCCAACCTACCCAGCTCCCTGGTGGAGCTCCGCATCCACGACAACCGCATCCGCAAGGTGCCCAAGGGAGTGTTCAGCGGGCTCCGGAACATGAACTGCATCGAGATGGGCGGGAACCCACTGGAGAACAGTGGCTTTGAACCTGGAGCCTTCGATGGCCTGAAGCTCAACTACCTGCGCATCTCAGAGGCCAAGCTGACTGGCATCCCCAAAGACCTCCCTGAGACCCTGAATGAACTCCACCTAGACCACAACAAAATCCAGGCCATCGAACTGGAGGACCTGCTTCGCTACTCCAAGCTGTACAGGCTGGGCCTAGGCCACAACCAGATCAGGATGATCGAGAACGGGAGCCTGAGCTTCCTGCCCACCCTCCGGGAGCTCCACTTGGACAACAACAAGTTGGCCAGGGTGCCCTCAGGGCTCCCAGACCTCAAGCTCCTCCAGGTGGTCTATCTGCACTCCAACAACATCACCAAAGTGGGTGTCAACGACTTCTGTCCCATGGGCTTCGGGGTGAAGCGGGCCTACTACAACGGCATCAGCCTCTTCAACAACCCCGTGCCCTACTGGGAGGTGCAGCCGGCCACTTTCCGCTGCGTCACTGACCGCCTGGCCATCCAGTTTGGCAACTACAAAAAGTAGAGGCAGCTGCAGCCACCGCGGGGCCTCAGTGGGGGTCTCTGGGGAACACAGCCAGACATCCTGATGGGGAGGCAGAGCCAGGAAGCTAAGCCAGGGCCCAGCTGCGTCCAACCCAGCCCCCCACCTCGGGTCCCTGACCCCAGCTCGATGCCCCATCACCGCCTCTCCCTGGCTCCCAAGGGTGCAGGTGGGCGCAAGGCCCGGCCCCCATCACATGTTCCCTTGGCCTCAGAGCTGCCCCTGCTCTCCCACCACAGCCACCCAGAGGCACCCCATGAAGCTTTTTTCTCGTTCACTCCCAAACCCAAGTGTCCAAGGCTCCAGTCCTAGGAGAACAGTCCCTGGGTCAGCAGCCAGGAGGCGGTCCATAAGAATGGGGACAGTGGGCTCTGCCAGGGCTGCCGCACCTGTCCAGACACACATGTTCTGTTCCTCCTCCTCATGCATTTCCAGCCTTTCAACCCTCCCCGACTCTGCGGCTCCCCTCAGCCCCCTTGCAAGTTCATGGCCTGTCCCTCCCAGACCCCTGCTCCACTGGCCCTTCGACCAGTCCTCCCTTCTGTTCTCTCTTTCCCCGTCCTTCCTCTCTCTCTCTCTCTCTCTC