Transcript asmbl_142957

Sequence
Transcript Sequence for observation asmbl_142957 of TGE0056988:
CAGTGCCCGGCTCCCCCCGGGTATCAAAAGAAGGATCGGCTCCGCCCCCGGGCTCCCCGGGGGAGTTGATAGAAGGGTCCTTCCCACCCTTTGCCGTCCCCACTCCTGTGCCTACGACCCAGGAGCGTGTCAGCCAAAGCATGGAGAATCAAGAGAAGGCGAGTATCGCGGGCCACATGTTCGACGTAGTCGTGATCGGAGGTGGCATTTCAGGACTATCTGCTGCCAAACTCTTGACTGAATATGGCGTTAGTGTTTTGGTTTTAGAAGCTCGGGACAGGGTTGGAGGAAGAACATATACTATAAGGAATGAGCATGTTGATTACGTAGATGTTGGTGGAGCTTATGTGGGACCAACCCAAAACAGAATCTTACGCTTGTCTAAGGAGCTGGGCATAGAGACTTACAAAGTGAATGTCAGTGAGCGTCTCGTTCAATATGTCAAGGGGAAAACATATCCATTTCGGGGCGCCTTTCCACCAGTATGGAATCCCATTGCATATTTGGATTACAATAATCTGTGGAGGACAATAGATAACATGGGGAAGGAGATTCCAACTGATGCACCCTGGGAGGCTCAACATGCTGACAAATGGGACAAAATGACCATGAAAGAGCTCATTGACAAAATCTGCTGGACAAAGACTGCTAGGCGGTTTGCTTATCTTTTTGTGAATATCAATGTGACCTCTGAGCCTCACGAAGTGTCTGCCCTGTGGTTCTTGTGGTATGTGAAGCAGTGCGGGGGCACCACTCGGATATTCTCTGTCACCAATGGTGGCCAGGAACGGAAGTTTGTAGGTGGATCTGGTCAAGTGAGCGAACGGATAATGGACCTCCTCGGAGACCAAGTGAAGCTGAACCATCCTGTCACTCACGTTGACCAGTCAAGTGACAACATCATCATAGAGACGCTGAACCATGAACATTATGAGTGCAAATACGTAATTAATGCGATCCCTCCGACCTTGACTGCCAAGATTCACTTCAGACCAGAGCTTCCAGCAGAGAGAAACCAGTTAATTCAGCGGCTTCCAATGGGAGCTGTCATTAAGTGCATGATGTATTACAAGGAGGCCTTCTGGAAGAAGAAGGATTACTGTGGCTGCATGATCATTGAAGATGAAGATGCTCCAATTTCAATAACCTTGGATGACACCAAGCCAGATGGGTCACTGCCTGCCATCATGGGCTTCATTCTTGCCCGGAAAGCTGATCGACTTGCTAAGCTACATAAGGAAATAAGGAAGAAGAAAATCTGTGAGCTCTATGCCAAAGTGCTGGGATCCCAAGAAGCTTTACATCCAGTGCATTATGAAGAGAAGAACTGGTGTGAGGAGCAGTACTCTGGGGGCTGCTACACGGCCTACTTCCCTCCTGGGATCATGACTCAATATGGAAGGGTGATTCGTCAACCCGTGGGCAGGATTTTCTTTGCGGGCACAGAGACTGCCACAAAGTGGAGCGGCTACATGGAAGGGGCAGTTGAGGCTGGAGAACGAGCAGCTAGGGAGGTCTTAAATGGTCTCGGGAAGGTGACCGAGAAAGATATCTGGGTACAAGAACCTGAATCAAAGGACGTTCCAGCGGTAGAAATCACCCACACCTTCTGGGAAAGGAACCTGCCCTCTGTTTCTGGCCTGCTGAAGATCATTGGATTTTCCACATCAGTAACTGCCCTGGGGTTTGTGCTGTACAAATACAAGCTCCTGCCACGGTCTTGAAGTTCTGTTCTTATGCTCTCTGCTCACTGGTTTTCAATACCACCAAGAGGAAAATATTGACAAGTTTAAAGGCTGTGTCATTGGGCCATGTTTAAGTGTACTGGATTTAACTACCTTTGGCTTAATTCCAATCATTGTTAAAGTAAAAACAATTCAAAGAATCACCTAATTAATTTCAGTAAGATCAAGCTCCATCTTATTTGTCAGTGTAGATCAACTCATGTTAATTGATAGAATAAAGCCTTGTGATCACTTTCTGAAATTCACAAAGTTAAACGTGATGTGCTCATCAGAAACAATTTCTGTGTCCTGTTTTTATTCCCTTCAATGCAAAATACATGATGATTTCAGAAACAAAGCATTTGACTTTCTGTCTGTGGAGGTGGAGTAGGTGAAGGCCCAGCCTGTAACTGTCCTTTTTCTTCCCTTAGGCAATGGTGAACTGTCATTACAGAGCCTAGAGGCTCACAGCCTCCTGGAGGAAGCAGCCTCCACTTTGGATCAGGAAATAGTAAAGGAAAGCAGTGTTGGGGGTAGCGGCATGCAGACCCTCAGACCAGAATGGGGACATCTTGTGGTCTGCTGCCTCAGGAATCTCCTGACCACTTGTAGTCCCTCCGACTTCTCTAGACATCTAGTCTCAGTGCTAGCTTATTTGTATTTTTCCTCTTTCACTTCTTATGGAGGAGAGTGTTTAACTGAGTTAGAATGTTGAAACTGACTTGCTGTGACTTATGTGCAGCTTTCCAGTTGAGCAGAGGAAAATAGTGGCAGGACTGTCCCCCAGGAGGACTCCCTGCTTAGCTCTGTGGGAGACCAACTACGACTGGCATCTTCTCTTCCCCCTGGAAGGCAGCTAGACACCAATGGATCCTTGTCAGTTGTAACATTCTATTTCAACTTCAGGAAAGCAGCAGTTTTCTTTTAATTTTTCCTATGACCATAAAATTAGACATACCTCTCAACTTACATATGTCTTCAACATGGTTACCTCTGCATAAATATTAGCAAAGCATGCCAATTTCTCTTAAGTACTGAAATACATATGATAAATTTGACTGTTATTTGTTGAGACTATCAAACAGAAAAGAAATTAGGGCTCTAATTTCCTTAAAGCAAGCTCACTTGCTTTAGTTGTTAAGTTTTATAAAAGACATGAAATTGAGTCATTTTATATATGAAAACTAAGTTCTCTATCTTAGGAGTAATGTCGGCCCACAAGGGTGCCCACCTCTTGTTTTCCCCTTTTAAAAACTCAGATTTTTAAAAGCCCTTTCCAAAGGTTTCAACTGTAAAATACTTCTTTTTACAATGTATCAACATATTTTTATTTAAGGGGAATTAACAATTGCCAGGGAAACCAGCCAACCCAAGTTTATTATATCATTAACCTTATCATAAATTCAAACCTAAGTTGCTGGACCCTGGTGTGAGGACATAAATCTTCCAAAGTTTTGCCTATCCTAAGAGCTGCATTTTTCTACTGCTCTTTACCTTGCATTTTAGCTAATTTAGGAGTTTTGAGAATGTATTGGATACGCTCCAGTACATAAGGAGTTGCCGCATATTATATCAGACTGCTTTGAGAAATCTCATCCCTAGTCTATTGCAGTTGTTTCTATTAGCTTACTGATTAACTCAGTCCTGACACACCTTTTGGGAAATGCTGATTTAAACTTCTTAACTGGCAACAGTTGGAACAGTAATCAGTTTGCTAACATATTTAAAGTCTTGAATGTTGAAGAACTCATGTGATTTACCCTTTTCAACTTTTTGGAAAACGATTTAATTTATTCTAATTAGATTAACCCTATTAATCTATGGATTGGGTATCAAAATGAATGCCAGTCCAGATGTGCCTAGACACGAAATTGGAGCTGAGGACTCTCACGATATGCAAGTTCATCCAACGTGAAGATACCATAAGCTTTTTCTCTGAACCAGAGAAATGAAAGTCAGTTTAAGAGGCTGATAGATCTTGGCCCTGTTAAGGCATCCACTTCACAGTTCTGAAGGCTGAGTCAGCCCCACTCCACAGTTAGGCCAAGAATTAGATTTTAAAACTTCATCTGTCTGTCCCAGTTAACTGTTAAATAAGGCCTCATCCTCCACTGAAGAGTATGGATTGAAGGATTGTGAACTATGTTTAGTGTGATTGTGAACTTGGTGCCTAATGTTCCATGTCTGAAGTTTGCCCCAGTGCTACACGTTGGAGTATACCTATGTGTGTGCTTTGCCACTGAAGTAAGATTTTGCCTGTATGGTACTGTTTTGTTTGTTAATAAAGTGCACTGCCACCCCCAA