Transcript asmbl_142956

Sequence
Transcript Sequence for observation asmbl_142956 of TGE0056124:
CAGTGCCCGGCTCCCCCCGGGTATCAAAAGAAGGATCGGCTCCGCCCCCGGGCTCCCCGGGGGAGTTGATAGAAGGGTCCTTCCCACCCTTTGCCGTCCCCACTCCTGTGCCTACGACCCAGGAGCGTGTCAGCCAAAGCATGGAGAATCAAGAGAAGGCGAGTATCGCGGGCCACATGTTCGACGTAGTCGTGATCGGAGGTGGCATTTCAGGCCAAGAGAAGAGATTGGCATGAACTGTTGCTTTGCCAGTTCCAGCCAGTACCAGCAAAAACATACATGTATGTTGGAGCATCAGAGGAAAGCAGCTCCTGGTGGAGAGACTATCTGCTGCCAAACTCTTGACTGAATATGGCGTTAGTGTTTTGGTTTTAGAAGCTCGGGACAGGGTTGGAGGAAGAACATATACTATAAGGAATGAGCATGTTGATTACGTAGATGTTGGTGGAGCTTATGTGGGACCAACCCAAAACAGAATCTTACGCTTGTCTAAGGAGCTGGGCATAGAGACTTACAAAGTGAATGTCAGTGAGCGTCTCGTTCAATATGTCAAGGGGAAAACATATCCATTTCGGGGCGCCTTTCCACCAGTATGGAATCCCATTGCATATTTGGATTACAATAATCTGTGGAGGACAATAGATAACATGGGGAAGGAGATTCCAACTGATGCACCCTGGGAGGCTCAACATGCTGACAAATGGGACAAAATGACCATGAAAGAGCTCATTGACAAAATCTGCTGGACAAAGACTGCTAGGCGGTTTGCTTATCTTTTTGTGAATATCAATGTGACCTCTGAGCCTCACGAAGTGTCTGCCCTGTGGTTCTTGTGGTATGTGAAGCAGTGCGGGGGCACCACTCGGATATTCTCTGTCACCAATGGTGGCCAGGAACGGAAGTTTGTAGGTGGATCTGGTCAAGTGAGCGAACGGATAATGGACCTCCTCGGAGACCAAGTGAAGCTGAACCATCCTGTCACTCACGTTGACCAGTCAAGTGACAACATCATCATAGAGACGCTGAACCATGAACATTATGAGTGCAAATACGTAATTAATGCGATCCCTCCGACCTTGACTGCCAAGATTCACTTCAGACCAGAGCTTCCAGCAGAGAGAAACCAGTTAATTCAGCGGCTTCCAATGGGAGCTGTCATTAAGTGCATGATGTATTACAAGGAGGCCTTCTGGAAGAAGAAGGATTACTGTGGCTGCATGATCATTGAAGATGAAGATGCTCCAATTTCAATAACCTTGGATGACACCAAGCCAGATGGGTCACTGCCTGCCATCATGGGCTTCATTCTTGCCCGGAAAGCTGATCGACTTGCTAAGCTACATAAGGAAATAAGGAAGAAGAAAATCTGTGAGCTCTATGCCAAAGTGCTGGGATCCCAAGAAGCTTTACATCCAGTGCATTATGAAGAGAAGAACTGGTGTGAGGAGCAGTACTCTGGGGGCTGCTACACGGCCTACTTCCCTCCTGGGATCATGACTCAATATGGAAGGGTGATTCGTCAACCCGTGGGCAGGATTTTCTTTGCGGGCACAGAGACTGCCACAAAGTGGAGCGGCTACATGGAAGGGGCAGTTGAGGCTGGAGAACGAGCAGCTAGGGAGGTCTTAAATGGTCTCGGGAAGGTGACCGAGAAAGATATCTGGGTACAAGAACCTGAATCAAAGGACGTTCCAGCGGTAGAAATCACCCACACCTTCTGGGAAAGGAACCTGCCCTCTGTTTCTGGCCTGCTGAAGATCATTGGATTTTCCACATCAGTAACTGCCCTGGGGTTTGTGCTGTACAAATACAAGCTCCTGCCACGGTCTTGAAGTTCTGTTCTTATGCTCTCTGCTCACTGGTTTTCAATACCACCAAGAGGAAAATATTGACAAGTTTAAAGGCTGTGTCATTGGGCCATGTTTAAGTGTACTGGATTTAACTACCTTTGGCTTAATTCCAATCATTGTTAAAGTAAAAACAATTCAAAGAATCACCTAATTAATTTCAGTAAGATCAAGCTCCATCTTATTTGTCAGTGTAGATCAACTCATGTTAATTGATAGAATAAAGCCTTGTGATCACTTTCTGAAATTCACAAAGTTAAACGTGATGTGCTCATCAGAAACAATTTCTGTGTCCTGTTTTTATTCCCTTCAATGCAAAATACATGATGATTTCAGAAACAAAGCATTTGACTTTCTGTCTGTGGAGGTGGAGTAGGTGAAGGCCCAGCCTGTAACTGTCCTTTTTCTTCCCTTAGGCAATGGTGAACTGTCATTACAGAGCCTAGAGGCTCACAGCCTCCTGGAGGAAGCAGCCTCCACTTTGGATCAGGAAATAGTAAAGGAAAGCAGTGTTGGGGGTAGCGGCATGCAGACCCTCAGACCAGAATGGGGACATCTTGTGGTCTGCTGCCTCAGGAATCTCCTGACCACTTGTAGTCCCTCCGACTTCTCTAGACATCTAGTCTCAGTGCTAGCTTATTTGTATTTTTCCTCTTTCACTTCTTATGGAGGAGAGTGTTTAACTGAGTTAGAATGTTGAAACTGACTTGCTGTGACTTATGTGCAGCTTTCCAGTTGAGCAGAGGAAAATAGTGGCAGGACTGTCCCCCAGGAGGACTCCCTGCTTAGCTCTGTGGGAGACCAACTACGACTGGCATCTTCTCTTCCCCCTGGAAGGCAGCTAGACACCAATGGATCCTTGTCAGTTGTAACATTCTATTTCAACTTCAGGAAAGCAGCAGTTTTCTTTTAATTTTTCCTATGACCATAAAATTAGACATACCTCTCAACTTACATATGTCTTCAACATGGTTACCTCTGCATAAATATTAGCAAAGCATGCCAATTTCTCTTAAGTACTGAAATACATATGATAAATTTGACTGTTATTTGTTGAGACTATCAAACAGAAAAGAAATTAGGGCTCTAATTTCCTTAAAGCAAGCTCACTTGCTTTAGTTGTTAAGTTTTATAAAAGACATGAAATTGAGTCATTTTATATATGAAAACTAAGTTCTCTATCTTAGGAGTAATGTCGGCCCACAAGGGTGCCCACCTCTTGTTTTCCCCTTTTAAAAACTCAGATTTTTAAAAGCCCTTTCCAAAGGTTTCAACTGTAAAATACTTCTTTTTACAATGTATCAACATATTTTTATTTAAGGGGAATTAACAATTGCCAGGGAAACCAGCCAACCCAAGTTTATTATATCATTAACCTTATCATAAATTCAAACCTAAGTTGCTGGACCCTGGTGTGAGGACATAAATCTTCCAAAGTTTTGCCTATCCTAAGAGCTGCATTTTTCTACTGCTCTTTACCTTGCATTTTAGCTAATTTAGGAGTTTTGAGAATGTATTGGATACGCTCCAGTACATAAGGAGTTGCCGCATATTATATCAGACTGCTTTGAGAAATCTCATCCCTAGTCTATTGCAGTTGTTTCTATTAGCTTACTGATTAACTCAGTCCTGACACACCTTTTGGGAAATGCTGATTTAAACTTCTTAACTGGCAACAGTTGGAACAGTAATCAGTTTGCTAACATATTTAAAGTCTTGAATGTTGAAGAACTCATGTGATTTACCCTTTTCAACTTTTTGGAAAACGATTTAATTTATTCTAATTAGATTAACCCTATTAATCTATGGATTGGGTATCAAAATGAATGCCAGTCCAGATGTGCCTAGACACGAAATTGGAGCTGAGGACTCTCACGATATGCAAGTTCATCCAACGTGAAGATACCATAAGCTTTTTCTCTGAACCAGAGAAATGAAAGTCAGTTTAAGAGGCTGATAGATCTTGGCCCTGTTAAGGCATCCACTTCACAGTTCTGAAGGCTGAGTCAGCCCCACTCCACAGTTAGGCCAAGAATTAGATTTTAAAACTTCATCTGTCTGTCCCAGTTAACTGTTAAATAAGGCCTCATCCTCCACTGAAGAGTATGGATTGAAGGATTGTGAACTATGTTTAGTGTGATTGTGAACTTGGTGCCTAATGTTCCATGTCTGAAGTTTGCCCCAGTGCTACACGTTGGAGTATACCTATGTGTGTGCTTTGCCACTGAAGTAAGATTTTGCCTGTATGGTACTGTTTTGTTTGTTAATAAAGTGCACTGCCACCCCCAA