Transcript asmbl_139997

Sequence
Transcript Sequence for observation asmbl_139997 of TGE0056119:
CCTAGGGGAAGGGGGAGCCCACAAGGTCCGAGCTGGGGGCCCTGGCCTGGAGAGAGCTGAAGCTGGAGTGCCAGCCGAATTCAGTATCTGGACCCGGGAAGCTGGTGCTGGAGGCCTGGCCATTGCTGTCGAGGGCCCCAGCAAGGCTGAGATCTCTTTTGAGGACCGCAAGGACGGCTCCTGTGGTGTGGCTTATGTGGTCCAGGAGCCAGGTACTGGGAACCCGGCTGGGGTTGGAGGAGGTGGGGCCTGAGTGTGGGTATTGGACCCAGGGCTGGCACAGATAGCCCTGCCTGGCACTCACTCTTCACTTTGAGGTCACAGGGCCACCCAGGCTGTTCGTGGGAGGTGGGAGGCCCAAAGGCTGATGAGCCGGTCTTACACTCTTTCCCTGCCCAGGTGACTACGAAGTCTCAGTCAAGTTCAACGAGGAACACATTCCCGACAGCCCCTTCGTGGTGCCTGTGGCTTCTCCGTCTGGCGACGCCCGCCGCCTCACTGTTTCTAGCCTTCAGGAGTCAGGGCTAAAGGTCAACCAGCCAGCCTCTTTTGCAGTCAGCCTGAACGGGGCCAAGGGGGCGATCGATGCCAAGGTGCACAGCCCCTCAGGAGCCCTGGAGGAGTGCTATGTCACAGAAATTGACCAAGATAAGTATGCTGTGCGCTTCATCCCTCGGGAGAATGGCGTTTACCTGATTGACGTCAAGTTCAACGGCACCCACATCCCTGGAAGCCCCTTCAAGATCCGAGTTGGGGAGCCTGGGCATGGAGGGGACCCAGGCTTGGTGTCTGCTTACGGAGCAGGTCTGGAAGGCGGTGTCACAGGGAACCCAGCTGAGTTCGTCGTGAACACGAGCAATGCGGGAGCTGGTGCCCTGTCGGTGACCATTGACGGCCCCTCCAAGGTGAAGATGGATTGCCAGGAGTGCCCTGAGGGCTACCGCGTCACCTATACCCCCATGGCACCTGGCAGCTACCTCATCTCCATCAAGTACGGCGGCCCCTACCACATTGGGGGCAGCCCCTTCAAGGCCAAAGTCACAGGCCCCCGTCTCGTCAGCAACCACAGCCTCCACGAGACATCATCAGTGTTTGTAGACTCTCTGACCAAGGCCACCTGTGCCCCCCAGCATGGGGCCCCGGGTCCTGGGCCTGCTGACGCCAGCAAGGTGGTGGCCAAGGGCCTGGGGCTGAGCAAGGCCTACGTAGGCCAGAAGAGCAGCTTCACAGTAGACTGCAGCAAAGCAGGCAACAACATGCTGCTGGTGGGGGTTCATGGCCCAAGGACCCCCTGCGAGGAGATCCTGGTGAAGCACGTGGGCAGCCGGCTCTACAGCGTGTCCTACCTGCTCAAGGACAAGGGGGAGTACACACTGGTGGTCAAATGGGGGGACGAGCACATCCCAGGCAGCCCCTACCGCGTTGTGGTGCCCTGAGTCTGGGGCCCGTGCCAGCCGGCAGCCCCCAAGCCTGCCCCGCTACCCAAGCAGCCCCGCCCTCTTCCCCTCAACCCCGGCCCAGGCCGCCCTGGCCGCCCGCCTGTCACTGCAGCCGCCCCTGCCCTGTGCCGTGCTGCGCTCACCTGCCTCCCCAGCCAGCCGCTGACCTCTCGGCTTTCACTTGGGCAGAGGGAGCCATTTGGTGGCGCTGCTTGTCTTCTTTGGTTCTGGGAGGGGTGAGGGATGGGGGTCCTGTACACAACCACCCACTAGTTCTCTTCTCCAGCCAAGAGGAATAAAGTTTTGCTTCCATTC