Transcript asmbl_13911

Sequence
Transcript Sequence for observation asmbl_13911 of TGE0056983:
CTGGTGGAAGAAAAGTCAGGCAAACACAAGCACGCACACACCACTGGGAGATCAGATCTTCTAGCTGGCTCTCTGCTGCCACAGCTCCGCCGAAGGGAGGGGGTGGAAGAGGAGGACTAAACTCAGAGCTGAGAGGAGAGGCAGGTGTGTGCAGGTGCATCACCTGGATCATGAGGTCACCCCTCTGCTGGCTCCTCCCACTTCTCATCTTGGCCTCAGTGGCCCAAGGCCAGCCAACAAGACGACCAAGACCCGGGACTGGGCCCGGGCGCAGACCCAGGCCCAGGCCCAGGCCCACACCCAGCTTTCCTCAGCCTGATGAACCAGCAGAGCCAACAGACCTGCCTCCTCCCCTCCCTCCAGGCCCTCCATCTATCTTCCCTGACTGTCCCCGCGAATGCTACTGCCCCCCTGATTTCCCATCTGCCCTCTACTGTGATAGCCGCAACCTGCGAAAGGTCCCTGTCATCCCGCCCCGCATCCATTACCTCTATCTCCAGAACAACTTCATCACTGAGCTCCCGGTGGAGTCCTTCCAGAATGCCACAGGCCTGCGATGGATTAACCTGGACAACAACCGAATCCGCAAGATAGACCAGAGGGTGCTGGAGAAACTGCCCGGCCTGGTGTTCCTCTACATGGAGAAGAACCAGTTGGAAGAGGTCCCCTCGGCCCTGCCCCGGAACCTGGAGCAGCTGAGGCTGAGCCAGAACCACATCTCCAGAATCCCGCCTGGTGTCTTCAGCAAGCTGGAGAACCTGCTGCTCCTGGATCTCCAGCACAACAGGCTGAGCGACGGCGTCTTCAAGCCCGACACCTTCCATGGCCTCAAGAACCTCATGCAGCTCAACCTGGCCCACAACATCCTGAGAAAGATGCCGCCCAGGGTCCCCACCGCCATTCACCAGCTCTACCTGGACAGTAACAAGATTGAGACCATCCCTAACGGATACTTCAAGAGCTTTCCCAATCTTGCCTTCATTCGGCTTAACTACAACAAGCTGACAGACAGGGGACTCCCCAAGAACTCCTTTAATATCTCCAACCTGCTTGTGCTCCACCTGTCCCACAACAGGATCAGCAGTGTGCCCGCCATCAACAACAGGCTGGAACACCTGTACCTCAACAACAATAGCATCGAGAAAATCAACGGAACCCAGATTTGCCCCAACGACCTAGTGGCGTTCCATGACTTCTCCTCGGACCTGGAGAACGTGCCACACCTGCGCTACCTGCGGCTGGATGGAAACTACTTGAAGCCGCCCATCCCGCTGGACCTCATGATGTGCTTCCGCCTCCTGCAGTCCGTGGTCATCTAGGCCCTACTCCGCCACCGGATCTGCTCTGACCGCACTTGAAGGCTGGGGCCCAGGCACCTGTGCCGGCCATTCGTTTTCTCTCTCTCCCTTTCTTTCTCCCAGCTTTGCCTCCCTTATCCCACCCTCGAGGCAGGGAAAAGCCATCTATTCTTCTGCAGCCTCAGGAGCGAGACTTCAAGGACTCAGTTTGGTTCCACCCAGTTGAAAGACACCCAGTGCACACCCAAACTCCTGGCCTTCTGTGGTTTCCCTTTGCTCCAGAAACACAGATGTGTCTAAAGACTTGGTGTCCCCTTCTCTCTCCTCCCCCACCCGCCACTCCTGGGTACATCTGGGCCGTGGACTATCTGATCTTGGTCCTGGCCGAGCAAACAGCCCGGAGGTAAGGTTCAGAAAGTCCCCCTGGGGACTCCTCCATCTTCGGCAGCTCTGGCTCAAAGAGGCCGAGAAACCCAGTTCTCCTGGGCCAAGGATCCCTTCTGGCAAAGCTGCTGCTCCGCCGCTTGGTTCCCCGGCACCAGACATCGCCCTGGCCCTGCTGGCCCGGGTATCGGGAAGGAGGAGCGAGGGAATGACGGAGGTAGGGTGCAGGGTCAGGGCTCCCGCAGGGGCCTGCATCTGGCCAGCAGGACACAGGGATGCGCAGGGCGCCCCCTTCTGTTCCAGGGTGAACATAGCACACGCCCTCCTGGCTGGGCCTCAGGAGGAACAGCCAAGGAGAAGAATGGCCCAAGGAACTAGGAAGCAGCCATGGGAGAGGGGAAGGGTTCAAGCCCGGGATGGGCCCGCGTGACGTCGATGGGTCCTGCGGCCCCCTTGCCCAACCTCGGGTTTAGGGAGGAGGGTTCACAGTGTTTTTGTGGGGGCGGGGGAAGGAAGAGGCAGCCCCGCCCCCGCCATCTGTTCTCCATCAGTGTGCGCGGCCCAGCCATTTCCACCCTCGGGAGGCGGCTCCTGAGAAACAGGGAGGAAGGGGCGGAGCACCTGGACGTCTCCCAGAAGCCCCTCCACGTTTGAAAATGCGCCTCCTCCTCGGAGACAGACGCATCGGTGCCACCTAGTGGCTGGTGGGAGTAACAGCTGGTCCCAGTCTTGCGCCTGGCCCTCTTCCTGGGGTGATTTTCCTCGGTGGAGGAGGCCCGTGGGGTCCCAACACGGAAGAGCCATGGGCCGTGTGCATGGTGTCGCTCTCCTCTAGGGTCTAGCGGGCACAAACGTCCCCAGGTGAGGACATAGTCGGC