Transcript asmbl_13910

Sequence
Transcript Sequence for observation asmbl_13910 of TGE0056983:
CTGGTGGAAGAAAAGTCAGGCAAACACAAGCACGCACACACCACTGGGAGATCAGATCTTCTAGCTGGCTCTCTGCTGCCACAGCTCCGCCGAAGGGAGGGGGTGGAAGAGGAGGACTAAACTCAGAGCTGAGAGGAGAGGCAGGTGTGTGCAGGTGCATCACCTGGATCATGAGGTCACCCCTCTGCTGGCTCCTCCCACTTCTCATCTTGGCCTCAGTGGCCCAAGGCCAGCCAACAAGACGACCAAGACCCGGGACTGGGCCCGGGCGCAGACCCAGGCCCAGGCCCAGGCCCACACCCAGCTTTCCTCAGCCTGATGAACCAGCAGAGCCAACAGACCTGCCTCCTCCCCTCCCTCCAGGCCCTCCATCTATCTTCCCTGACTGTCCCCGCGAATGCTACTGCCCCCCTGATTTCCCATCTGCCCTCTACTGTGATAGCCGCAACCTGCGAAAGGTCCCTGTCATCCCGCCCCGCATCCATTACCTCTATCTCCAGAACAACTTCATCACTGAGCTCCCGGTGGAGTCCTTCCAGAATGCCACAGGCCTGCGATGGATTAACCTGGACAACAACCGAATCCGCAAGATAGACCAGAGGGTGCTGGAGAAACTGCCCGGCCTGGTGTTCCTCTACATGGAGAAGAACCAGTTGGAAGAGGTCCCCTCGGCCCTGCCCCGGAACCTGGAGCAGCTGAGGCTGAGCCAGAACCACATCTCCAGAATCCCGCCTGGTGTCTTCAGCAAGCTGGAGAACCTGCTGCTCCTGGATCTCCAGCACAACAGGCTGAGCGACGGCGTCTTCAAGCCCGACACCTTCCATGGCCTCAAGAACCTCATGCAGCTCAACCTGGCCCACAACATCCTGAGAAAGATGCCGCCCAGGGTCCCCACCGCCATTCACCAGCTCTACCTGGACAGTAACAAGATTGAGACCATCCCTAACGGATACTTCAAGAGCTTTCCCAATCTTGCCTTCATTCGGCTTAACTACAACAAGCTGACAGACAGGGGACTCCCCAAGAACTCCTTTAATATCTCCAACCTGCTTGTGCTCCACCTGTCCCACAACAGGATCAGCAGTGTGCCCGCCATCAACAACAGGCTGGAACACCTGTACCTCAACAACAATAGCATCGAGAAAATCAACGGAACCCAGATTTGCCCCAACGACCTAGTGGCGTTCCATGACTTCTCCTCGGACCTGGAGAACGTGCCACACCTGCGCTACCTGCGGCTGGATGGAAACTACTTGAAGCCGCCCATCCCGCTGGACCTCATGATGTGCTTCCGCCTCCTGCAGTCCGTGGTCATCTAGGCCCTACTCCGCCACCGGATCTGCTCTGACCGCACTTGAAGGCTGGGGCCCAGGCACCTGTGCCGGCCATTCGTTTTCTCTCTCTCCCTTTCTTTCTCCCAGCTTTGCCTCCCTTATCCCACCCTCGAGGCAGGGAAAAGCCATCTATTCTTCTGCAGCCTCAGGAGCGAGACTTCAAGGACTCAGTTTGGTTCCACCCAGTTGAAAGACACCCAGTGCACACCCAAACTCCTGGCCTTCTGTGGTTTCCCTTTGCTCCAGAAACACAGATGTGTCTAAAGACTTGGTGTCCCCTTCTCTCTCCTCCCCCACCCGCCACTCCTGGGTACATCTGGGCCGTGGACTATCTGATCTTGGTCCTGGCCGAGCAAACAGCCCGGAGGTAAGGTTCAGAAAGTCCCCCTGGGGACTCCTCCATCTTCGGCAGCTCTGGCTCAAAGAGGCCGAGAAACCCAGTTCTCCTGGGCCAAGGATCCCTTCTGGCAAAGCTGCTGCTCCGCCGCTTGGTTCCCCGGCACCAGACATCGCCCTGGCCCTGCTGGCCCGGGTATCGGGAAGGAGGAGCGAGGGAATGACGGAGGTAGGGTGCAGGGTCAGGGCTCCCGCAGGGGCCTGCATCTGGCCAGCAGGACACAGGGATGCGCAGGGCGCCCCCTTCTGTTCCAGGGTGAACATAGCACACGCCCTCCTGGCTGGGCCTCAGGAGGAACAGCCAAGGAGAAGAATGGCCCAAGGAACTAGGAAGCAGCCATGGGAGAGGGGAAGGGTTCAAGCCCGGGATGGGCCCGCGTGACGTCGATGGGTCCTGCGGCCCCCTTGCCCAACCTCGGGTTTAGGGAGGAGGGTTCACAGTGTTTTTGTGGGGGCGGGGGAAGGAAGAGGCAGCCCCGCCCCCGCCATCTGTTCTCCATCAGTGTGCGCGGCCCAGCCATTTCCACCCTCGGGAGGCGGCTCCTGAGAAACAGGGAGGAAGGGGCGGAGCACCTGGACGTCTCCCAGAAGCCCCTCCACGTTTGAAAATGCGCCTCCTCCTCGGAGACAGACGCATCGGTGCCACCTAGTGGCTGGTGGGAGTAACAGCTGGTCCCAGTCTTGCGCCTGGCCCTCTTCCTGGGGTGATTTTCCTCGGTGGAGGAGGCCCGTGGGGTCCCAACACGGAAGAGCCATGGGCCGTGTGCATGGTGTCGCTCTCCTCTAGGGTCTAGCGGGCACAAACGTCCCCAGGCTGGGCTCATTCCCATCGTGAGTGAGCCCAGGTGAGGACATAGTCGGCTCCCGTTTGTTGTAGGCCCTTCCCAGGTGCCTTCTCAGCTCCCTCATCTGTAAACCGAGGAGGTGGATAAGATGCTCCCGGCCGGGC