Transcript asmbl_13840

Sequence
Transcript Sequence for observation asmbl_13840 of TGE0056982:
GAACATTTTCCAACGGAGAATTTCCCTAGCTTAATAAGAAAAAGTCCAAGAGCCGGTCACAGCATTAACATTTAGTGGGAGTGCAGTGAGAATTGGGTTTAACTTCTGGCATTTCTGGGCTTGTGGCTTGTGGTTGATTTTTTATTTACTTTGCAAAAGTTTCTGATAGGCGGAGCATCTAGTTTCAACTTCCTTTTGCAGCAAGTTCTTTCCTGCACTAATCACAATTCTTGGAAGAGGAGAACTGGACGTTGTGAACAGAGTTAGCTGGTAAATGTCCTCTTAAAAGATCCAAAAAATGAGACTTCTAGCAAAGATTATTTGCCTTATGTTATGGGCTATTTGTGTAGCAGAAGATTGCAATGAACTTCCTCCAAGAAGAAATACAGAAATTCTGACAGGTTCCTGGTCTGACCAAACATATCCAGAAGGCACCCAGGCTATCTATAAATGCCGCCCTGGATATAGATCTCTTGGAAATGTAATAATGGTATGCAGGAAGGGAGAATGGGTTGCTCTTAATCCATTAAGGAAATGTCAGAAAAGGCCCTGTGGACATCCTGGAGATACTCCTTTTGGTACTTTTACCCTTACAGGAGGAAATGTGTTTGAATATGGTGTAAAAGCTGTGTATACATGTAATGAGGGGTATCAATTGCTAGGTGAGATTAATTACCGTGAATGTGACACAGATGGATGGACCAATGATATTCCTATATGTGAAGTTGTGAAGTGTTTACCAGTGACAGCACCAGAGAATGGAAAAATTGTCAGTAGTGCAATGGAACCAGATCGGGAATACCATTTTGGACAAGCAGTACGGTTTGTATGTAACTCAGGCTACAAGATTGAAGGAGATGAAGAAATGCATTGTTCAGACGATGGTTTTTGGAGTAAAGAGAAACCAAAGTGTGTGGAAATTTCATGCAAATCCCCAGATGTTATAAATGGATCTCCTATATCTCAGAAGATTATTTATAAGGAGAATGAACGATTTCAATATAAATGTAACATGGGTTATGAATACAGTGAAAGAGGAGATGCTGTATGCACTGAATCTGGATGGCGTCCGTTGCCTTCATGTGAAGAAAAATCATGTGATAATCCTTATATTCCAAATGGTGACTACTCACCTTTAAGGATTAAACACAGAACTGGAGATGAAATCACGTACCAGTGTAGAAATGGTTTTTATCCTGCAACCCGGGGAAATACAGCAAAATGCACAAGTACTGGCTGGATACCTGCTCCGAGATGTACCTTGAAACCTTGTGATTATCCAGACATTAAACATGGAGGTCTATATCATGAGAATATGCGTAGACCATACTTTCCAGTAGCTGTAGGAAAATATTACTCCTATTACTGTGATGAACATTTTGAGACTCCGTCAGGAAGTTACTGGGATCACATTCATTGCACACAAGATGGATGGTCGCCAGCAGTACCATGCCTCAGAAAATGTTATTTTCCTTATTTGGAAAATGGATATAATCAAAATCATGGAAGAAAGTTTGTACAGGGTAAATCTATAGACGTTGCCTGCCATCCTGGCTACGCTCTTCCAAAAGCGCAGACCACAGTTACATGTATGGAGAATGGCTGGTCTCCTACTCCCAGATGCATCCGTGTCAGCTTTACCCTCTGAACTTCTGATCGAAGGTCATCCCTCTCCAGCTTGAGTGGATCAAAGATGACAAGGGCCAATGGAACCAAGTTTGAGTCTTGCCAGGTCAATACTTGGGTCCTGAGTATGGTGACTAGTATCTGTTTTGTTATGTGTGTATTATTCCAGCCAGAATGGGAAATGCTAATTCAGCTCCTCCAGGCAGCCCAATGGGGCTGGTGGCTTTGAGATTATTAAACTCTTTCTCTGCTGCAAACCCCACTGTCTCAGTGTATTGTTCTGTTGCTGTGCAGCAGGCATACAAATCTGACAATCTCGTAACTATTTGTGGCAAGCCAGGTCGAGGTCACTCTCTTTGAGGGCATTTACTCACTGCCTAGTGCCCCCTTTCCACTGGGACAGACCCAGAGACAAACCCTAGCAGCTTACTTAGCTCTCATGAACTAAGGGCTGTCCCTTAGTTCTCCCAAAGTAACCCACAATGCAACCCTGATGGGCTGCATCTTCCAAAATTGAAAGGCCTTTGTCTATCATTCCATGAAACAAAAAAAGATTATCTTACTTTTTAACATGGCTTAACCTTAATACCCACTGGATTTCGGAGAACAGTGGCCACTGCATGGTTCTCATGCTTACAGTACGATCCTGTAGCTAGATTTGT