Transcript asmbl_134785

Sequence
Transcript Sequence for observation asmbl_134785 of TGE0056981:
AAAGTGGGAAAGGATGTCTGGAGGCGAGGCGTCCCATTACAGAGGAAGGAGCTCGCTATATAAGCCAGCCAAAGTTGGCTGCACCGGCCACAGCCTGCCTACTGTCACCCGCCTCTCCCGCGCGCAGATACACGCCCCCGCCTCCGTGGGCACAAAGGCAGCGCTGCTGGGGAACTCGGGGGAACGCGCACGTGGGAACCGCCGCAGCTCCACACTCCAGGTACTTCTTCCAAGGACCTAGGTCTCTCGCCCATCGGAAAGAAAATAATTCTTTCAAGAAGATCAGGGACAACTGATTTGAAGTCTACTCTGTGCTTCTAAATCCCCAATTCTGCTGAAAGTGAGATACCCTAGAGCCCTAGAGCCCCAGCAGCACCCAGCCAAACCCACCTCCACCATGGGGGCCATGACTCAGCTGTTGGCAGGTGTCTTTCTTGCTTTCCTTGCCCTCGCTACCGAAGGTGGGGTCCTCAAGAAAGTCATCCGGCACAAGCGACAGAGTGGGGTGAACGCCACCCTGCCAGAAGAGAACCAGCCAGTGGTGTTTAACCACGTTTACAACATCAAGCTGCCAGTGGGATCCCAGTGTTCGGTGGATCTGGAGTCAGCCAGTGGGGAGAAAGACCTGGCACCGCCTTCAGAGCCCAGCGAAAGCTTTCAGGAGCACACAGTGGATGGGGAAAACCAGATTGTCTTCACACATCGCATCAACATCCCCCGCCGGGCCTGTGGCTGTGCCGCAGCCCCTGATGTTAAGGAGCTGCTGAGCAGACTGGAGGAGCTGGAGAACCTGGTGTCTTCCCTGAGGGAGCAATGTACTGCAGGAGCAGGCTGCTGTCTCCAGCCTGCCACAGGCCGCTTGGACACCAGGCCCTTCTGTAGCGGTCGGGGCAACTTCAGCACTGAAGGATGTGGCTGTGTCTGCGAACCTGGCTGGAAAGGCCCCAACTGCTCTGAGCCCGAATGTCCAGGCAACTGTCACCTTCGAGGCCGGTGCATTGATGGGCAGTGCATCTGTGACGACGGCTTCACGGGCGAGGACTGCAGCCAGCTGGCTTGCCCCAGCGACTGCAATGACCAGGGCAAGTGCGTAAATGGAGTCTGCATCTGTTTCGAAGGCTACGCCGGGGCTGACTGCAGCCGTGAAATCTGCCCAGTGCCCTGCAGTGAGGAGCACGGCACATGTGTAGATGGCTTGTGTGTGTGCCACGATGGCTTTGCAGGCGATGACTGCAACAAGCCTCTGTGTCTCAACAATTGCTACAACCGTGGACGATGCGTGGAGAATGAGTGCGTGTGTGATGAGGGTTTCACGGGCGAAGACTGCAGTGAGCTCATCTGCCCCAATGACTGCTTCGACCGGGGCCGCTGCATCAATGGCACCTGCTACTGCGAAGAAGGCTTCACAGGTGAAGACTGCGGGAAACCCACCTGCCCACATGCCTGCCACACCCAGGGCCGGTGTGAGGAGGGGCAGTGTGTATGTGATGAGGGCTTTGCCGGTGTGGACTGCAGCGAGAAGAGGTGTCCTGCTGACTGTCACAATCGTGGCCGCTGTGTAGACGGGCGGTGTGAGTGTGATGATGGTTTCACTGGAGCTGACTGTGGGGAGCTCAAGTGTCCCAATGGCTGCAGTGGCCATGGCCGCTGTGTCAATGGGCAGTGTGTGTGTGATGAGGGCTATACTGGGGAGGACTGCAGCCAGCTACGGTGCCCCAATGACTGTCACAGTCGGGGCCGCTGTGTCGAGGGCAAATGTGTATGTGAGCAAGGCTTCAAGGGCTATGACTGCAGTGACATGAGCTGCCCTAATGACTGTCACCAGCACGGCCGCTGTGTGAATGGCATGTGTGTTTGTGATGACGGCTACACAGGGGAAGACTGCCGGGATCGCCAATGCCCCAGGGACTGCAGCAACAGGGGCCTCTGTGTGGACGGACAGTGCGTCTGTGAGGACGGCTTCACCGGCCCTGACTGTGCAGAACTCTCCTGTCCAAATGACTGCCATGGCCAGGGTCGCTGTGTGAATGGGCAGTGCGTGTGCCATGAAGGATTTATGGGCAAAGACTGCAAGGAGCAAAGATGTCCCAGTGACTGTCATGGCCAGGGCCGCTGCGTGGACGGCCAGTGCATCTGCCACGAGGGCTTCACAGGCCTGGACTGTGGCCAGCACTCCTGCCCCAGTGACTGCAACAACTTAGGACAATGCGTCTCGGGCCGCTGCATCTGCAACGAGGGCTACAGCGGAGAAGACTGCTCAGAGGTGTCTCCTCCCAAAGACCTCGTTGTGACAGAAGTGACGGAAGAGACGGTCAACCTGGCCTGGGACAATGAGATGCGGGTCACAGAGTACCTTGTCGTGTACACGCCCACCCACGAGGGTGGTCTGGAAATGCAGTTCCGTGTGCCTGGGGACCAGACGTCCACCATCATCCAGGAGCTGGAGCCTGGTGTGGAGTACTTTATCCGTGTATTTGCCATCCTGGAGAACAAGAAGAGCATTCCTGTCAGCGCCAGGGTGGCCACGTACTTACCTGCACCTGAAGGCCTGAAATTCAAGTCCATCAAGGAGACATCTGTGGAAGTGGAGTGGGATCCTCTAGACATTGCTTTTGAAACCTGGGAGATCATCTTCCGGAATATGAATAAAGAAGATGAGGGAGAGATCACCAAAAGCCTGAGGAGGCCAGAGACCTCTTACCGGCAAACTGGTCTAGCTCCTGGGCAAGAGTATGAGATATCTCTGCACATAGTGAAAAACAATACCCGGGGCCCTGGCCTGAAGAGGGTGACCACCACACGCTTGGATGCCCCCAGCCAGATCGAGGTGAAAGATGTCACAGACACCACTGCCTTGATCACCTGGTTCAAGCCCCTGGCTGAGATCGATGGCATTGAGCTGACCTACGGCATCAAAGACGTGCCAGGAGACCGTACCACCATCGATCTCACAGAGGACGAGAACCAGTACTCCATCGGGAACCTGAAGCCTGACACTGAGTACGAGGTGTCCCTCATCTCCCGCAGAGGTGACATGTCAAGCAACCCAGCCAAAGAGACCTTCACAACAGGCCTCGATGCTCCCAGGAATCTTCGACGTGTTTCCCAGACAGATAACAGCATCACCCTGGAATGGAGGAATGGCAAGGCAGCTATTGACAGTTACAGAATTAAGTATGCCCCCATCTCTGGAGGGGACCACGCTGAGGTTGATGTTCCAAAGAGCCAACAAGCCACAACCAAAACCACACTCACAGGTCTGAGGCCGGGAACTGAATATGGGATTGGAGTTTCTGCTGTGAAGGAAGACAAGGAGAGCAATCCAGCGACCATCAACGCAGCCACAGAGTTGGACACGCCCAAGGACCTTCAGGTTTCTGAAACTGCAGAGACCAGCCTGACCCTGCTCTGGAAGACACCGTTGGCCAAATTTGACCGCTACCGCCTCAATTACAGTCTCCCCACAGGCCAGTGGGTGGGAGTGCAGCTTCCAAGAAACACCACTTCCTATGTCCTGAGAGGCCTGGAACCAGGACAGGAGTACAATGTCCTCCTGACAGCCGAGAAAGGCAGACACAAGAGCAAGCCCGCACGTGTGAAGGCATCCACTGAACAAGCCCCTGAGCTGGAAAACCTCACCGTGACTGAGGTTGGCTGGGATGGCCTCAGACTCAACTGGACCGCAGCTGACCAGGCCTATGAGCACTTTATCATTCAGGTGCAGGAGGCCAACAAGGTGGAGGCAGCTCGGAACCTCACCGTGCCTGGCAGCCTTCGGGCTGTGGACATACCGGGCCTCAAGGCTGCTACGCCTTATACAGTCTCCATCTATGGGGTGATCCAGGGCTATAGAACACCAGTGCTCTCTGCTGAGGCCTCCACAGGGGAAACTCCCAATTTGGGAGAGGTCGTGGTGGCCGAGGTGGGCTGGGATGCCCTCAAACTCAACTGGACTGCTCCAGAAGGGGCCTATGAGTACTTTTTCATTCAGGTGCAGGAGGCTGACACAGTAGAGGCAGCCCAGAACCTCACCGTCCCAGGAGGACTGAGGTCCACAGACCTGCCTGGGCTCAAAGCAGCCACTCATTATACCATCACCATCCGCGGGGTCACTCAGGACTTCAGCACAACCCCTCTCTCTGTTGAAGTCTTGACAGAGGATCTCCCACAGCTGGGAGATTTAGCCGTGT