Transcript asmbl_134783

Sequence
Transcript Sequence for observation asmbl_134783 of TGE0056980:
AAAGTGGGAAAGGATGTCTGGAGGCGAGGCGTCCCATTACAGAGGAAGGAGCTCGCTATATAAGCCAGCCAAAGTTGGCTGCACCGGCCACAGCCTGCCTACTGTCACCCGCCTCTCCCGCGCGCAGATACACGCCCCCGCCTCCGTGGGCACAAAGGCAGCGCTGCTGGGGAACTCGGGGGAACGCGCACGTGGGAACCGCCGCAGCTCCACACTCCAGGTACTTCTTCCAAGGACCTAGGTCTCTCGCCCATCGGAAAGAAAATAATTCTTTCAAGAAGATCAGGGACAACTGATTTGAAGTCTACTCTGTGCTTCTAAATCCCCAATTCTGCTGAAAGTGAGATACCCTAGAGCCCTAGAGCCCCAGCAGCACCCAGCCAAACCCACCTCCACCATGGGGGCCATGACTCAGCTGTTGGCAGGTGTCTTTCTTGCTTTCCTTGCCCTCGCTACCGAAGGTGGGGTCCTCAAGAAAGTCATCCGGCACAAGCGACAGAGTGGGGTGAACGCCACCCTGCCAGAAGAGAACCAGCCAGTGGTGTTTAACCACGTTTACAACATCAAGCTGCCAGTGGGATCCCAGTGTTCGGTGGATCTGGAGTCAGCCAGTGGGGAGAAAGACCTGGCACCGCCTTCAGAGCCCAGCGAAAGCTTTCAGGAGCACACAGTGGATGGGGAAAACCAGATTGTCTTCACACATCGCATCAACATCCCCCGCCGGGCCTGTGGCTGTGCCGCAGCCCCTGATGTTAAGGAGCTGCTGAGCAGACTGGAGGAGCTGGAGAACCTGGTGTCTTCCCTGAGGGAGCAATGTACTGCAGGAGCAGGCTGCTGTCTCCAGCCTGCCACAGGCCGCTTGGACACCAGGCCCTTCTGTAGCGGTCGGGGCAACTTCAGCACTGAAGGATGTGGCTGTGTCTGCGAACCTGGCTGGAAAGGCCCCAACTGCTCTGAGCCCGAATGTCCAGGCAACTGTCACCTTCGAGGCCGGTGCATTGATGGGCAGTGCATCTGTGACGACGGCTTCACGGGCGAGGACTGCAGCCAGCTGGCTTGCCCCAGCGACTGCAATGACCAGGGCAAGTGCGTAAATGGAGTCTGCATCTGTTTCGAAGGCTACGCCGGGGCTGACTGCAGCCGTGAAATCTGCCCAGTGCCCTGCAGTGAGGAGCACGGCACATGTGTAGATGGCTTGTGTGTGTGCCACGATGGCTTTGCAGGCGATGACTGCAACAAGCCTCTGTGTCTCAACAATTGCTACAACCGTGGACGATGCGTGGAGAATGAGTGCGTGTGTGATGAGGGTTTCACGGGCGAAGACTGCAGTGAGCTCATCTGCCCCAATGACTGCTTCGACCGGGGCCGCTGCATCAATGGCACCTGCTACTGCGAAGAAGGCTTCACAGGTGAAGACTGCGGGAAACCCACCTGCCCACATGCCTGCCACACCCAGGGCCGGTGTGAGGAGGGGCAGTGTGTATGTGATGAGGGCTTTGCCGGTGTGGACTGCAGCGAGAAGAGGTGTCCTGCTGACTGTCACAATCGTGGCCGCTGTGTAGACGGGCGGTGTGAGTGTGATGATGGTTTCACTGGAGCTGACTGTGGGGAGCTCAAGTGTCCCAATGGCTGCAGTGGCCATGGCCGCTGTGTCAATGGGCAGTGTGTGTGTGATGAGGGCTATACTGGGGAGGACTGCAGCCAGCTACGGTGCCCCAATGACTGTCACAGTCGGGGCCGCTGTGTCGAGGGCAAATGTGTATGTGAGCAAGGCTTCAAGGGCTATGACTGCAGTGACATGAGCTGCCCTAATGACTGTCACCAGCACGGCCGCTGTGTGAATGGCATGTGTGTTTGTGATGACGGCTACACAGGGGAAGACTGCCGGGATCGCCAATGCCCCAGGGACTGCAGCAACAGGGGCCTCTGTGTGGACGGACAGTGCGTCTGTGAGGACGGCTTCACCGGCCCTGACTGTGCAGAACTCTCCTGTCCAAATGACTGCCATGGCCAGGGTCGCTGTGTGAATGGGCAGTGCGTGTGCCATGAAGGATTTATGGGCAAAGACTGCAAGGAGCAAAGATGTCCCAGTGACTGTCATGGCCAGGGCCGCTGCGTGGACGGCCAGTGCATCTGCCACGAGGGCTTCACAGGCCTGGACTGTGGCCAGCACTCCTGCCCCAGTGACTGCAACAACTTAGGACAATGCGTCTCGGGCCGCTGCATCTGCAACGAGGGCTACAGCGGAGAAGACTGCTCAGAGGTGTCTCCTCCCAAAGACCTCGTTGTGACAGAAGTGACGGAAGAGACGGTCAACCTGGCCTGGGACAATGAGATGCGGGTCACAGAGTACCTTGTCGTGTACACGCCCACCCACGAGGGTGGTCTGGAAATGCAGTTCCGTGTGCCTGGGGACCAGACGTCCACCATCATCCAGGAGCTGGAGCCTGGTGTGGAGTACTTTATCCGTGTATTTGCCATCCTGGAGAACAAGAAGAGCATTCCTGTCAGCGCCAGGGTGGCCACGTACTTACCTGCACCTGAAGGCCTGAAATTCAAGTCCATCAAGGAGACATCTGTGGAAGTGGAGTGGGATCCTCTAGACATTGCTTTTGAAACCTGGGAGATCATCTTCCGGAATATGAATAAAGAAGATGAGGGAGAGATCACCAAAAGCCTGAGGAGGCCAGAGACCTCTTACCGGCAAACTGGTCTAGCTCCTGGGCAAGAGTATGAGATATCTCTGCACATAGTGAAAAACAATACCCGGGGCCCTGGCCTGAAGAGGGTGACCACCACACGCTTGGATGCCCCCAGCCAGATCGAGGTGAAAGATGTCACAGACACCACTGCCTTGATCACCTGGTTCAAGCCCCTGGCTGAGATCGATGGCATTGAGCTGACCTACGGCATCAAAGACGTGCCAGGAGACCGTACCACCATCGATCTCACAGAGGACGAGAACCAGTACTCCATCGGGAACCTGAAGCCTGACACTGAGTACGAGGTGTCCCTCATCTCCCGCAGAGGTGACATGTCAAGCAACCCAGCCAAAGAGACCTTCACAACAGGCCTCGATGCTCCCAGGAATCTTCGACGTGTTTCCCAGACAGATAACAGCATCACCCTGGAATGGAGGAATGGCAAGGCAGCTATTGACAGTTACAGAATTAAGTATGCCCCCATCTCTGGAGGGGACCACGCTGAGGTTGATGTTCCAAAGAGCCAACAAGCCACAACCAAAACCACACTCACAGGTCTGAGGCCGGGAACTGAATATGGGATTGGAGTTTCTGCTGTGAAGGAAGACAAGGAGAGCAATCCAGCGACCATCAACGCAGCCACAGAGTTGGACACGCCCAAGGACCTTCAGGTTTCTGAAACTGCAGAGACCAGCCTGACCCTGCTCTGGAAGACACCGTTGGCCAAATTTGACCGCTACCGCCTCAATTACAGTCTCCCCACAGGCCAGTGGGTGGGAGTGCAGCTTCCAAGAAACACCACTTCCTATGTCCTGAGAGGCCTGGAACCAGGACAGGAGTACAATGTCCTCCTGACAGCCGAGAAAGGCAGACACAAGAGCAAGCCCGCACGTGTGAAGGCATCCACTGCCATGGGCTCCCCAAAGGAAGTCATTTTCTCAGACATCACTGAAAATTCGGCTACTGTCAGCTGGAGGGCACCCACAGCCCAAGTGGAGAGCTTCCGGATTACCTATGTGCCCATTACAGGAGGTACACCCTCCATGGTAACTGTGGACGGAACCAAGACTCAGACCAGGCTGGTGAAACTCATACCTGGCGTGGAGTACCTTGTCAGCATCATCGCCATGAAGGGCTTTGAGGAAAGTGAACCTGTCTCAGGGTCATTCACCACAGCTCTGGATGGCCCATCTGGCCTGGTGACAGCCAACATCACTGACTCAGAAGCCTTGGCCAGGTGGCAGCCAGCCATTGCCACTGTGGACAGTTATGTCATCTCCTACACAGGCGAGAAAGTGCCAGAAATTACACGCACGGTGTCCGGGAACACAGTGGAGTATGCTCTGACCGACCTCGAGCCTGCCACGGAATACACACTGAGAATCTTTGCAGAGAAAGGGCCCCAGAAGAGCTCAACCATCACTGCCAAGTTCACAACAGACCTCGATTCTCCAAGAGACTTGACTGCTACTGAGGTTCAGTCGGAAACTGCCCTCCTTACCTGGCGACCCCCCCGGGCATCAGTCACCGGTTACCTGCTGGTCTATGAATCAGTGGATGGCACAGTCAAGGAAGTCATTGTGGGTCCAGATACCACCTCCTACAGCCTGGCAGACCTGAGCCCATCCACCCACTACACAGCCAAGATCCAGGCACTCAATGGGCCCCTGAGGAGCAATATGATCCAGACCATCTTCACCACAATTGGACTCCTGTACCCCTTCCCCAAGGACTGCTCCCAAGCAATGCTGAATGGAGACACGACCTCTGGCCTCTACACCATTTATCTGAATGGTGATAAGGCTGAGGCGCTGGAAGTCTTCTGTGACATGACCTCTGATGGGGGTGGATGGATTGTGTTCCTGAGACGCAAAAACGGACGCGAGAACTTCTACCAAAACTGGAAGGCATATGCTGCTGGATTTGGGGACCGCAGAGAAGAATTCTGGCTTGGGCTGGACAACCTGAACAAAATCACAGCCCAGGGGCAGTACGAGCTCCGGGTGGACCTGCGGGACCATGGGGAGACAGCCTTTGCTGTCTATGACAAGTTCAGCGTGGGAGATGCCAAGACTCGCTACAAGCTGAAGGTGGAGGGGTACAGTGGGACAGCAGGTGACTCCATGGCCTACCACAATGGCAGATCCTTCTCCACCTTTGACAAGGACACAGATTCAGCCATCACCAACTGTGCTCTGTCCTACAAAGGGGCTTTCTGGTACAGGAACTGTCACCGTGTCAACCTGATGGGGAGATATGGGGACAATAACCACAGTCAGGGCGTTAACTGGTTCCACTGGAAGGGCCACGAACACTCAATCCAGTTTGCTGAGATGAAGCTGAGACCAAGCAACTTCAGAAATCTTGAAGGCAGGCGCAAACGGGCATAAATTCCAGGGACCACTGGGTGAGAGAGGAATAAGGCCCAGAGCGAGGAAAGGATTTTACCAAAGCATCAATACAACCAGCCCAACCATCGGTCCACACCTGGGCATTTGGTGAGAGTCAAAGCTGACCATGGATCCCTGGGGCCAACGGCAACAGCATGGGCCTCACCTCCTCTGTGATTTCTTTCTTTGCACCAAAGACATCAGTCTCCAACATGTTTCTGTTTTGTTGTTTGATTCAGCAAAAATCTCCCAGTGACAACATCGCAATAGTTTTTTACTTCTCTTAGGTGGCTCTGGGAATGGGAGAGGGGTAGGATGTACAGGGGTAGTTTGTTTTAGAACCAGCCGTATTTTACATGAAGCTGTATAATTAATTGTCATTATTTTTGTTAGCAAAGATTAAATGTGTCATTGGAAGCCATCCCTTTTTTTACATTTCATACAACAGAAACCAGAAAAGCAATACTGTTTCCATTTTAAGGATATGATTAATATTATTAATATAATAATGATGATGATGATGATGAAAACTAAGGATTTTTCAAGAGATCTTTCTTTCCAAAACATTTCTGGACAGTACCTGATTGTATTTTTTTTTTAAATAAAAGCACAAGTACTTTTGA