Transcript asmbl_134602

Sequence
Transcript Sequence for observation asmbl_134602 of TGE0056108:
TTTCACCCTAGAGAAAGAATGCTGGCAAAGATCTCTACCACATGGAAACTGTTCTTAAAGCTGCTGGGCCCTGAAATTTTACTCAGCAGTTTGAAATCAAGACATAGCTTTTCTCATTCACCCTCCCACTTGGGGCTAATGCACAGACATGAACATCTATTGAGGAAAACCACAAAAAACTTCAAAACAGCTACAACGGGAAAAAGAGAGTTTTGTCCCACAGTCAGCAGGCCACTAGTTTATTAACTTCCAGTCACCTTGATTTTTGCTAAAATGAAGACTCTGCAGTCTACACTTCTCCTGTTACTGCTTGTGCCTCTGATAAAGCCAGCACCACCAACCCAGCAGGACTCACGCATTATCTATGATTATGGAACAGATAATTTTGAAGAATCCATATTTAGCCAAGATTATGAGGATAAATACCTGGATGGAAAAAATATTAAGGAAAAAGAAACTGTGATAATACCCAATGAGAAAAGTCTTCAATTACAAAAAGATGAGGCAATAACACCATTACCTCCCAAGAAAGAAAATGATGAAATGCCCACGTGTCTGCTGTGTGTTTGTTTAAGTGGCTCTGTATACTGTGAAGAAGTTGACATTGATGCTGTACCACCCTTACCAAAGGAATCAGCCTATCTTTACGCACGATTCAACAAAATTAAAAAGCTGACTGCCAAAGATTTTGCAGACATACCTAACTTAAGAAGACTCGATTTTACAGGAAATTTGATAGAAGATATAGAAGATGGTACTTTTTCAAAACTTTCTCTGTTAGAAGAACTTTCACTTGCTGAAAATCAACTACTAAAACTTCCAGTTCTTCCTCCCAAGCTCACTTTATTTAATGCAAAATACAACAAAATCAAGAGTAGGGGAATCAAAGCAAATGCATTCAAAAAACTGAATAACCTCACCTTCCTCTACTTGGACCATAATGCCCTGGAATCCGTGCCTCTTAATTTACCAGAAAGTCTACGTGTAATTCATCTTCAGTTCAACAACATAGCTTCAATTACAGATGACACATTCTGCAAGGCTAATGACACCAGTTACATCCGGGACCGCATTGAAGAGATACGCCTGGAGGGCAATCCAATCGTCCTGGGAAAGCATCCAAACAGTTTTATTTGCTTAAAAAGATTACCGATAGGGTCATACTTTTAACCTCTATTGGTACAACATATAAATGAAAGTACACCTACACTAATAGTCTGTCTCAACAATGAGTAAAGGAACTTAAGTATTGGTTTAATATTAACCTTGTATCTCATTTTGAAGGAATTTAATATTTTAAGCAAGGATGTTCAAAATCTTACATATAATAAGTAAAAAGTAAGACTGAATGTCTACGTTCGAAACAAAGTAATATGAAAATATTTAAACAGCATTACAAAATCCTAGTTTATACTAGACTACCATTTAAAAATCATGTTTTTATATAAATGCCCAAATTTGAGATGCATTATTCCTATTACTAATGATGTAAGTACGAGGATAAATCCAAGAAACTTTCAACTCTTTGCCTTTCCTGGCCTTTACTGGATCCCAAAAGCATTTAAGGTACATGTTCCAAAAACTTTGAAAAGCTAAATGTTTCCCATGATCGCTCATTCTTCTTTTATGATTCATACGTTATTCCTTATAAAGTAAGAACTTTGTTTTCCTCCTATCAAGGCAGCTATTTTATTAAATTTTTCACTTAGTCTGAGAAATAGCAGATAGTCTCATATTTAGGAAAACTTTCCAAATAAAATAAATGTTATTCTCTGATAAAGAGCTAATACAGAAATGTTCAAGTTATTTTACTTTCTGGTAATGTCTTCAGTAAAATATTTTCTTTATCTAAATATTAACATTCTAAGTCTACCAAAAAAAGTTTTAAACTCAAGCAGGCCAAAACCAATATGCTTATAAGAAATAATGAAAAGTTCATCCATTTCTGATAAAGTTCTCTATGGCAAAGTCTTTCAAATACGAGATAACTGCAAAATATTTTCCTTTTATACTACAGAAATGAGAATCTCATCAATAAATTAGTTCAAGCATAAGATGAAAACAGAATATTCTGTGGTGCCAGTGCACACTACCTTCCCACCCATACACATCCATGTTCACTGTAACAAACTGAATATTCACAATAAAGCTTCTGAGTAACACTTTCTGATTACTCATGATAAACTGACATGGCTAACTGCAAGAATTAAATCTTCTATCTGAGAGTAATAATTTATGATGACTCAGTGGTGCCAGAGTAAAGTTTCTAAAATAACATTCCTCTCACTTGTACCCCACTAAAAGTATTAGACTACACATTACATTGAAGTTAAACACAAAATTATCAGTGTTTTAGAAACATGAGTCCGGACTGTGTAAGTAAAAGTACAAACATTATTTCCACCATAAAGTATGTATTGAAATCAAGTTGTCTCTGTGTACAGAATACATACTTATTCCCATTTTTAAGCATTTGCTTCTGTTTTCCCTACCTAGAATGTCAGATGTTTTTCAGTTATCTCCCCATTTGTCAAAGTTGACCTCAAGATAACATTTTTCATTAAAGCATCTGAGATCTAAGAACACAATTATTATTCTAACAATGATTATTAGCTCATTCACTTATTTTGATAACTAATGATCACAGCTATTATACTACTTTCTCGTTATTTTGTGTGCATGCCTCATTTCCCTGACTTAAACCTCACTGAGAGCGCAAAATGCAGCTTTATACTTTTTACTTTCAATTGCCTAGCACAATAGTGAGTACATTTGAATTGAATATATAATAAATATTGCAAAATAAAATCCATCTAAATAGAAGGGTTCTGTTTTATTTGGAAAAATTGAATCTTTAAACTATCATAATCTTGAATGACTGTCATCTTTCTAGTTTTCAGAAAAATAATGTATTCCTATATTATTTTTATGATAAAACTTATGGAGCAAAACACCATCAAATAACTCTCAAATTAAGAAAAAATTCAAAAGTCAGTAGTTTTAGATAAGATAATGATAAGGGAGAAAGAACATTGGTAAAAGGTATGAATTCCAGAATTAAAGAAATAATTTGGGGATTTCTAGATAAGAGGATATATATGAACATGCATACCTTACACCTTCATATACACAACCTTAAATCACAAATAAAACAAAATAAACAATACAAATTATACCACCAAGATTCAGAAGATATCAGACGAAATAATTAGAGAAAGTAAAAATATGCTGTCTCCATTATATTCATAATGTTTCATTCTTGACACTAATAATTAGAGGCTTTAAATTTTTAAATGATTTACTTTTTACTAACATTGCTGAAAAAAACTAAAGACATACATAAATGGAAAGATGTCTTGTGTTTATGGATGGTAAGATTTAATGTTGTTAAGACAACAATACTATCCAATATGATATGCAGACTGAACACAGTTGCCATCAAAATCTCAATGATGCTTTCACACAAATAAAATGGAACTTCAAGAGACCCCCAAATAAAGAGAAGAATCTTGAAAATAAGAATAAAGATAGAAGACTCACATTTCCTAACTTCAACATTTACAACAAAGATACAGTAATGAAAACAGTGTGTGGCTGGGCGCAATGGCTCACACCTGTAATCCCAGC