Transcript asmbl_134601

Sequence
Transcript Sequence for observation asmbl_134601 of TGE0056108:
ACATCCTCTAAGCTTTTAAATATTGCTTCGATGGTCTGAATTTTTATTTCCAGGGAAAAAGAGAGTTTTGTCCCACAGTCAGCAGGCCACTAGTTTATTAACTTCCAGTCACCTTGATTTTTGCTAAAATGAAGACTCTGCAGTCTACACTTCTCCTGTTACTGCTTGTGCCTCTGATAAAGCCAGCACCACCAACCCAGCAGGACTCACGCATTATCTATGATTATGGAACAGATAATTTTGAAGAATCCATATTTAGCCAAGATTATGAGGATAAATACCTGGATGGAAAAAATATTAAGGAAAAAGAAACTGTGATAATACCCAATGAGAAAAGTCTTCAATTACAAAAAGATGAGGCAATAACACCATTACCTCCCAAGAAAGAAAATGATGAAATGCCCACGTGTCTGCTGTGTGTTTGTTTAAGTGGCTCTGTATACTGTGAAGAAGTTGACATTGATGCTGTACCACCCTTACCAAAGGAATCAGCCTATCTTTACGCACGATTCAACAAAATTAAAAAGCTGACTGCCAAAGATTTTGCAGACATACCTAACTTAAGAAGACTCGATTTTACAGGAAATTTGATAGAAGATATAGAAGATGGTACTTTTTCAAAACTTTCTCTGTTAGAAGAACTTTCACTTGCTGAAAATCAACTACTAAAACTTCCAGTTCTTCCTCCCAAGCTCACTTTATTTAATGCAAAATACAACAAAATCAAGAGTAGGGGAATCAAAGCAAATGCATTCAAAAAACTGAATAACCTCACCTTCCTCTACTTGGACCATAATGCCCTGGAATCCGTGCCTCTTAATTTACCAGAAAGTCTACGTGTAATTCATCTTCAGTTCAACAACATAGCTTCAATTACAGATGACACATTCTGCAAGGCTAATGACACCAGTTACATCCGGGACCGCATTGAAGAGATACGCCTGGAGGGCAATCCAATCGTCCTGGGAAAGCATCCAAACAGTTTTATTTGCTTAAAAAGATTACCGATAGGGTCATACTTTTAACCTCTATTGGTACAACATATAAATGAAAGTACACCTACACTAATAGTCTGTCTCAACAATGAGTAAAGGAACTTAAGTATTGGTTTAATATTAACCTTGTATCTCATTTTGAAGGAATTTAATATTTTAAGCAAGGATGTTCAAAATCTTACATATAATAAGTAAAAAGTAAGACTGAATGTCTACGTTCGAAACAAAGTAATATGAAAATATTTAAACAGCATTACAAAATCCTAGTTTATACTAGACTACCATTTAAAAATCATGTTTTTATATAAATGCCCAAATTTGAGATGCATTATTCCTATTACTAATGATGTAAGTACGAGGATAAATCCAAGAAACTTTCAACTCTTTGCCTTTCCTGGCCTTTACTGGATCCCAAAAGCATTTAAGGTACATGTTCCAAAAACTTTGAAAAGCTAAATGTTTCCCATGATCGCTCATTCTTCTTTTATGATTCATACGTTATTCCTTATAAAGTAAGAACTTTGTTTTCCTCCTATCAAGGCAGCTATTTTATTAAATTTTTCACTTAGTCTGAGAAATAGCAGATAGTCTCATATTTAGGAAAACTTTCCAAATAAAATAAATGTTATTCTCTGATAAAGAGCTAATACAGAAATGTTCAAGTTATTTTACTTTCTGGTAATGTCTTCAGTAAAATATTTTCTTTATCTAAATATTAACATTCTAAGTCTACCAAAAAAAGTTTTAAACTCAAGCAGGCCAAAACCAATATGCTTATAAGAAATAATGAAAAGTTCATCCATTTCTGATAAAGTTCTCTATGGCAAAGTCTTTCAAATACGAGATAACTGCAAAATATTTTCCTTTTATACTACAGAAATGAGAATCTCATCAATAAATTAGTTCAAGCATAAGATGAAAACAGAATATTCTGTGGTGCCAGTGCACACTACCTTCCCACCCATACACATCCATGTTCACTGTAACAAACTGAATATTCACAATAAAGCTTCTGAGTAACACTTTCTGATTACTCATGATAAACTGACATGGCTAACTGCAAGAATTAAATCTTCTATCTGAGAGTAATAATTTATGATGACTCAGTGGTGCCAGAGTAAAGTTTCTAAAATAACATTCCTCTCACTTGTACCCCACTAAAAGTATTAGACTACACATTACATTGAAGTTAAACACAAAATTATCAGTGTTTTAGAAACATGAGTCCGGACTGTGTAAGTAAAAGTACAAACATTATTTCCACCATAAAGTATGTATTGAAATCAAGTTGTCTCTGTGTACAGAATACATACTTATTCCCATTTTTAAGCATTTGCTTCTGTTTTCCCTACCTAGAATGTCAGATGTTTTTCAGTTATCTCCCCATTTGTCAAAGTTGACCTCAAGATAACATTTTTCATTAAAGCATCTGAGATCTAAGAACACAATTATTATTCTAACAATGATTATTAGCTCATTCACTTATTTTGATAACTAATGATCACAGCTATTATACTACTTTCTCGTTATTTTGTGTGCATGCCTCATTTCCCTGACTTAAACCTCACTGAGAGCGCAAAATGCAGCTTTATACTTTTTACTTTCAATTGCCTAGCACAATAGTGAGTACATTTGAATTGAATATATAATAAATATTGCAAAATAAAATCCATCTAAATAGAAGGGTTCTGTTTTATTTGGAAAAATTGAATCTTTAAACTATCATAATCTTGAATGACTGTCATCTTTCTAGTTTTCAGAAAAATAATGTATTCCTATATTATTTTTATGATAAAACTTATGGAGCAAAACACCATCAAATAACTCTCAAATTAAGAAAAAATTCAAAAGTCAGTAGTTTTAGATAAGATAATGATAAGGGAGAAAGAACATTGGTAAAAGGTATGAATTCCAGAATTAAAGAAATAATTTGGGGATTTCTAGATAAGAGGATATATATGAACATGCATACCTTACACCTTCATATACACAACCTTAAATCACAAATAAAACAAAATAAACAATACAAATTATACCACCAAGATTCAGAAGATATCAGACGAAATAATTAGAGAAAGTAAAAATATGCTGTCTCCATTATATTCATAATGTTTCATTCTTGACACTAATAATTAGAGGCTTTAAATTTTTAAATGATTTACTTTTTACTAACATTGCTGAAAAAAACTAAAGACATACATAAATGGAAAGATGTCTTGTGTTTATGGATGGTAAGATTTAATGTTGTTAAGACAACAATACTATCCAATATGATATGCAGACTGAACACAGTTGCCATCAAAATCTCAATGATGCTTTCACACAAATAAAATGGAACTTCAAGAGACCCCCAAATAAAGAGAAGAATCTTGAAAATAAGAATAAAGATAGAAGACTCACATTTCCTAACTTCAACATTTACAACAAAGATACAGTAATGAAAACAGTGTGTGGCTGGGCGCAATGGCTCACACCTGTAATCCCAGC