Transcript asmbl_134413

Sequence
Transcript Sequence for observation asmbl_134413 of TGE0056978:
AGAGTTCTAGCCTGAAAGGGAACTCGGGCGTCGTCCTGGCGTCCTCTCCGGATTGCGCCGCACCCTCGCTTCCTGCCAGGGAGGGGCTGCCGGGCTTTGGCGGCTCCCGAGCATCGAGAACGGGGCCAGAGCAGCTTCCTGCCTGCCCCCCGCGACCATAGAGCGCGGGCCCAGGGCGCCGCCCGCGGGTGGGGGACGTTCCCAGGACGGAAGTGGCCGAGAGAGTGTCGAAGGGAGGGCGAGGCCGGAGCCCGAGGGCGACCCGAGAAGCGGCGGGGCGGCGGGCCGGCGGGCGGGGCGCAGAGCCAGGCAGCGCAGGTATAGCCAGGCTGGAGAAAAGAAGCTGCCACCATGGTTGCACTTTCACTGAAGATCAGCATTGGGAATGTGGTGAAGACGATGCAGTTTGAGCCGTCTACCATGGTGTACGACGCCTGCCGCATCATTCGTGAGCGGATCCCAGAGGCCCCAGCTGGTCCTCCCAGCGACTTTGGGCTCTTTCTGTCAGATGATGACCCCAAAAAGGGTATATGGCTGGAGGCTGGGAAAGCTTTGGACTACTACATGCTCCGAAATGGGGACACTATGGAGTACAGGAAGAAACAGAGACCCCTGAAGATCCGTATGCTGGATGGAACTGTGAAGACGATCATGGTGGATGACTCTAAGACTGTCACTGACATGCTCATGACCATCTGTGCCCGCATTGGCATCACCAATCATGATGAATATTCATTGGTTCGAGAGCTGATGGAAGAGAAAAAGGAGGAAATAACAGGGACCTTAAGAAAGGACAAGACATTGCTGCGAGATGAAAAGAAGATGGAGAAACTAAAGCAGAAATTGCACACAGATGATGAGTTGAACTGGCTGGACCATGGTCGGACACTGAGGGAGCAGGGTGTAGAGGAGCACGAGACGCTGCTGCTGCGGAGGAAGTTCTTTTACTCAGACCAGAATGTGGATTCCCGGGACCCTGTACAGCTGAACCTCCTGTATGTGCAGGCACGAGATGACATCCTGAATGGCTCCCACCCTGTCTCCTTTGACAAGGCCTGTGAGTTTGCTGGCTTCCAATGCCAGATCCAGTTTGGGCCCCACAATGAGCAGAAGCACAAGGCTGGCTTCCTTGACCTGAAGGACTTCCTGCCCAAGGAGTATGTGAAGCAGAAGGGAGAGCGTAAGATCTTCCAGGCACACAAGAATTGTGGGCAGATGAGTGAGATTGAGGCCAAGGTCCGCTACGTGAAGCTAGCCCGTTCTCTCAAGACTTACGGTGTCTCCTTCTTCCTGGTGAAGGAAAAAATGAAAGGGAAGAACAAGCTAGTGCCCAGGCTTCTGGGCATCACCAAGGAGTGTGTGATGCGAGTGGATGAGAAGACCAAGGAAGTGATCCAGGAGTGGAACCTCACCAACATCAAACGCTGGGCTGCGTCTCCCAAAAGCTTCACCCTGGATTTTGGAGATTACCAAGATGGCTATTACTCAGTACAGACAACTGAAGGGGAGCAGATTGCACAGCTCATTGCCGGCTACATCGATATCATCCTGAAGAAGAAAAAAAGCAAGGATCACTTTGGGCTGGAAGGAGATGAGGAGTCTACTATGCTGGAGGACTCAGTGTCCCCCAAAAAGTCAACAGTCCTGCAGCAGCAATACAACCGGGTGGGGAAAGTGGAGCATGGCTCTGTGGCCCTGCCTGCCATCATGCGCTCTGGAGCCTCTGGTCCTGAGAATTTCCAGGTGGGCAGCATGCCCCCTGCCCAGCAGCAGATTACCAGCGGCCAGATGCACCGAGGACACATGCCTCCTCTGACTTCAGCCCAGCAGGCACTCACTGGAACCATTAACTCCAGCATGCAGGCCGTGCAGGCTGCCCAGGCCACCCTGGATGACTTTGACACTCTGCCGCCTCTTGGCCAGGATGCTGCCTCTAAGGCCTGGCGTAAAAACAAGATGGATGAATCAAAGCATGAGATCCACTCTCAGGTAGATGCCATCACAGCTGGTACTGCGTCTGTGGTGAACCTGACAGCAGGGGACCCTGCTGAGACAGACTATACCGCAGTGGGCTGTGCAGTCACCACAATCTCCTCCAACCTGACGGAGATGTCCCGTGGGGTGAAGCTGCTGGCTGCCTTGCTGGAGGACGAAGGCGGCAGTGGTCGGCCCCTGTTGCAGGCAGCAAAGGGCCTTGCGGGAGCAGTGTCAGAACTGCTGCGCAGTGCCCAACCAGCCAGTGCTGAGCCCCGTCAGAACCTGCTGCAAGCAGCTGGGAACGTGGGCCAGGCCAGTGGGGAGCTGTTGCAACAAATTGGGGAAAGTGATACTGACCCCCACTTCCAGGATGCGCTAATGCAGCTCGCCAAAGCTGTGGCAAGTGCTGCAGCTGCCCTGGTCCTCAAGGCCAAGAGTGTGGCCCAGCGGACAGAGGACTCGGGACTTCAGACCCAAGTTATTGCTGCAGCAACACAGTGTGCCCTATCCACTTCCCAACTAGTGGCCTGTACTAAGGTGGTGGCACCTACAATCAGCTCACCTGTCTGCCAAGAGCAACTGGTGGAGGCTGGACGACTGGTAGCCAAAGCCGTGGAGGGCTGTGTGTCTGCCTCCCAGGCAGCTACAGAGGATGGGCAACTGTTGCGAGGGGTAGGAGCAGCAGCCACAGCTGTCACCCAGGCCCTAAATGAGCTGCTGCAGCATGTGAAAGCCCATGCCACAGGGGCTGGGCCTGCTGGCCGTTATGACCAGGCTACTGACACCATCCTAACCGTCACTGAGAACATCTTTAGCTCCATGGGTGATGCTGGGGAGATGGTGCGACAGGCCCGCATCCTGGCCCAAGCCACATCTGACCTGGTCAATGCCATCAAGGCTGATGCTGAGGGGGAAAGTGATCTGGAGAACTCCCGCAAGCTCTTAAGTGCTGCCAAGATCCTAGCTGATGCCACAGCCAAGATGGTAGAGGCTGCCAAGGGAGCAGCTGCCCACCCTGACAGTGAGGAGCAGCAGCAGCGGCTGCGGGAGGCAGCTGAGGGGCTGCGCATGGCCACCAATGCAGCTGCGCAGAATGCCATCAAGAAAAAGCTGGTGCAGCGCCTGGAGCATGCAGCCAAGCAGGCTGCAGCCTCAGCCACACAGACCATCGCTGCAGCTCAGCACGCAGCCTCTACCCCCAAGGCCTCTGCCGGCCCCCAGCCCCTGCTGGTGCAGAGCTGCAAGGCAGTGGCAGAGCAGATTCCACTGCTGGTGCAGGGCGTCCGAGGAAGCCAAGCCCAGCCTGACAGCCCCAGCGCTCAGCTTGCCCTCATTGCTGCCAGCCAGAGCTTCCTGCAGCCAGGTGGGAAGATGGTGGCAGCTGCAAAGGCCTCAGTGCCAACGATTCAGGACCAGGCTTCAGCCATGCAGCTGAGTCAGTGTGCCAAGAACCTGGGCACCGCGCTGGCTGAACTCCGGACGGCTGCCCAGAAGGCTCAGGAAGCATGTGGACCTTTGGAGATGGATTCTGCACTGAGTGTGGTACAGAATCTAGAGAAAGATCTACAGGAAGTGAAGGCAGCAGCTCGAGATGGCAAGCTTAAACCCTTACCTGGGGAGACAATGGAGAAGTGTACCCAGGACCTGGGCAACAGCACCAAAGCCGTGAGCTCAGCCATCGCCCAGCTACTGGGAGAGGTTGCCCAGGGCAATGAGAATTATGCAGGTATTGCAGCTCGGGATGTGGCAGGTGGGCTGCGGTCACTGGCCCAGGCCGCTAGGGGAGTCGCTGCACTGACGTCAGATCCTGCAGTGCAGGCCATTGTACTTGATACGGCCAGTGATGTGCTGGACAAGGCCAGCAGCCTCATTGAGGAGGCGAAAAAGGCAGCTGGCCATCCAGGGGACCCTGAGAGCCAGCAGCGGCTTGCCCAGGTGGCTAAAGCAGTGACCCAGGCTCTGAACCGCTGTGTCAGCTGCCTACCTGGCCAGCGCGATGTGGATAATGCCCTGAGGGCAGTTGGAGATGCCAGCAAGCGACTCCTGAGTGACTCGCTTCCTCCTAGCACTGGGACATTTCAAGAAGCTCAGAGCCGGTTGAATGAAGCTGCTGCTGGGCTGAATCAGGCAGCCACAGAACTGGTGCAGGCCTCTCGGGGAACCCCTCAGGACCTGGCTCGAGCCTCAGGCCGATTTGGACAGGACTTCAGCACCTTCCTGGAAGCTGGTGTGGAGATGGCAGGCCAGGCTCCGAGCCAGGAGGACCGAGCCCAAGTTGTGTCCAACTTGAAGGGCATCTCCATGTCTTCAAGCAAACTTCTTCTGGCTGCCAAGGCCCTGTCCACGGACCCTGCTGCCCCTAACCTCAAGAGTCAGCTGGCTGCAGCTGCCAGGGCAGTAACTGACAGCATCAATCAGCTCATCACTATGTGCACCCAGCAGGCACCCGGCCAGAAGGAGTGTGATAACGCCCTGCGGGAATTGGAGACGGTCCGGGAACTCCTGGAGAACCCAGTCCAGCCCATCAATGACATGTCCTACTTTGGTTGCCTGGACAGTGTAATGGAGAACTCAAAGGTGCTGGGCGAGGCCATGACTGGCATCTCCCAAAATGCCAAGAACGGAAACCTGCCAGAGTTTGGAGATGCCATTTCCACAGCCTCAAAGGCACTTTGTGGCTTCACCGAGGCAGCTGCACAGGCTGCATATCTGGTTGGTGTCTCTGACCCCAATAGCCAAGCTGGACAGCAAGGGCTAGTGGAGCCCACACAGTTTGCCCGTGCAAACCAGGCAATTCAGATGGCCTGCCAGAGTTTGGGAGAGCCTGGCTGTACCCAGGCCCAGGTGCTCTCTGCAGCCACCATTGTGGCTAAACACACCTCTGCACTGTGTAACAGCTGTCGCCTGGCTTCTGCCCGTACCACCAATCCTACTGCCAAGCGCCAGTTTGTACAGTCAGCCAAGGAGGTGGCCAACAGCACAGCTAATCTTGTCAAGACCATCAAGGCGCTAGATGGGGCCTTCACAGAGGAGAACCGTGCCCAGTGCCGAGCAGCAACAGCCCCTCTGCTGGAGGCTGTGGACAATCTGAGTGCCTTTGCGTCCAACCCTGAGTTCTCCAGCATTCCTGCCCAGATCAGCCCTGAGGGTCGGGCTGCCATGGAGCCCATTGTGATCTCTGCCAAGACAATGTTAGAGAGTGCCGGGGGACTCATCCAGACAGCCCGGGCCCTCGCAGTCAATCCCCGGGACCCCCCGAGCTGGTCGGTGCTGGCCGGCCACTCCCGTACTGTCTCAGACTCCATCAAGAAGCTAATTACAAGCATGAGGGACAAGGCTCCAGGGCAGCTGGAGTGTGAAACGGCCATTGCAGCTCTGAACAGTTGTCTACGGGACCTAGACCAGGCTTCCCTCGCTGCAGTCAGCCAGCAGCTTGCTCCCCGTGAGGGAATCTCTCAAGAGGCCTTGCACACTCAGATGCTCACTGCAGTCCAAGAGATCTCCCATCTCATTGAGCCGCTGGCCAATGCTGCCCGGGCTGAAGCCTCCCAGCTGGGACACAAGGTGTCCCAGATGGCGCAGTACTTTGAGCCGCTCACCCTGGCTGCAGTGGGTGCTGCCTCCAAGACCCTGAGCCACCCGCAGCAGATGGCACTCCTGGACCAGACTAAAACATTGGCAGAGTCTGCCCTGCAGTTGCTATACACTGCCAAGGAGGCTGGTGGTAACCCAAAGCAAGCAGCTCACACCCAGGAAGCCCTGGAGGAGGCTGTGCAGATGATGACCGAGGCCGTAGAGGACCTGACAACAACCCTCAACGAGGCAGCCAGTGCTGCTGGGGTCGTGGGTGGCATGGTGGACTCCATCACCCAGGCCATCAACCAGCTAGATGAAGGACCAATGGGTGAACCAGAAGGTTCCTTCGTGGATTACCAAACAACTATGGTGCGGACAGCCAAGGCCATTGCAGTGACCGTTCAGGAGATGGTTACCAAGTCAAACACCAGCCCAGAGGAGCTGGGCCCTCTTGCTAACCAGCTGACCAGTGACTATGGCCGTCTGGCCTCGGAGGCCAAGCCTGCAGCGGTGGCTGCTGAAAATGAAGAGATAGGTTCCCATATCAAACACCGGGTACAGGAGCTGGGCCATGGCTGTGCCGCTCTGGTCACCAAGGCAGGCGCCCTGCAGTGCAGCCCCAGTGATGCCTACACCAAGAAGGAGCTCATAGAGTGTGCCCGGAGAGTCTCTGAGAAGGTCTCCCACGTCCTGGCTGCGCTCCAGGCTGGGAATCGTGGCACCCAGGCCTGCATCACAGCAGCCAGCGCTGTGTCTGGTATCATTGCTGACCTCGACACCACCATCATGTTCGCCACTGCTGGCACGCTCAATCGTGAGGGTACTGAAACTTTCGCTGACCACCGGTAAGACAGGAACTGGGCCTAAGGGAGGCAGACAGGTCGGGGCACGGGGCTGGAAGAGGCAGGATAGCATTCGCTGGAATGGGGAAGACCTGGACCAGGCACCTTGGACGGGCTGGAGCGGGTAGGGGAGATCTGACTAAGCTGGGCCCTCCCTCAGGGAGGGCATCCTGAAGACTGC