Transcript asmbl_134410

Sequence
Transcript Sequence for observation asmbl_134410 of TGE0003009:
AGAGTTCTAGCCTGAAAGGGAACTCGGGCGTCGTCCTGGCGTCCTCTCCGGATTGCGCCGCACCCTCGCTTCCTGCCAGGGAGGGGCTGCCGGGCTTTGGCGGCTCCCGAGCATCGAGAACGGGGCCAGAGCAGCTTCCTGCCTGCCCCCCGCGACCATAGAGCGCGGGCCCAGGGCGCCGCCCGCGGGTGGGGGACGTTCCCAGGACGGAAGTGGCCGAGAGAGTGTCGAAGGGAGGGCGAGGCCGGAGCCCGAGGGCGACCCGAGAAGCGGCGGGGCGGCGGGCCGGCGGGCGGGGCGCAGAGCCAGGCAGCGCAGGTATAGCCAGGCTGGAGAAAAGAAGCTGCCACCATGGTTGCACTTTCACTGAAGATCAGCATTGGGAATGTGGTGAAGACGATGCAGTTTGAGCCGTCTACCATGGTGTACGACGCCTGCCGCATCATTCGTGAGCGGATCCCAGAGGCCCCAGCTGGTCCTCCCAGCGACTTTGGGCTCTTTCTGTCAGATGATGACCCCAAAAAGGGTATATGGCTGGAGGCTGGGAAAGCTTTGGACTACTACATGCTCCGAAATGGGGACACTATGGAGTACAGGAAGAAACAGAGACCCCTGAAGATCCGTATGCTGGATGGAACTGTGAAGACGATCATGGTGGATGACTCTAAGACTGTCACTGACATGCTCATGACCATCTGTGCCCGCATTGGCATCACCAATCATGATGAATATTCATTGGTTCGAGAGCTGATGGAAGAGAAAAAGGAGGAAATAACAGGGACCTTAAGAAAGGACAAGACATTGCTGCGAGATGAAAAGAAGATGGAGAAACTAAAGCAGAAATTGCACACAGATGATGAGTTGAACTGGCTGGACCATGGTCGGACACTGAGGGAGCAGGGTGTAGAGGAGCACGAGACGCTGCTGCTGCGGAGGAAGTTCTTTTACTCAGACCAGAATGTGGATTCCCGGGACCCTGTACAGCTGAACCTCCTGTATGTGCAGGCACGAGATGACATCCTGAATGGCTCCCACCCTGTCTCCTTTGACAAGGCCTGTGAGTTTGCTGGCTTCCAATGCCAGATCCAGTTTGGGCCCCACAATGAGCAGAAGCACAAGGCTGGCTTCCTTGACCTGAAGGACTTCCTGCCCAAGGAGTATGTGAAGCAGAAGGGAGAGCGTAAGATCTTCCAGGCACACAAGAATTGTGGGCAGATGAGTGAGATTGAGGCCAAGGTCCGCTACGTGAAGCTAGCCCGTTCTCTCAAGACTTACGGTGTCTCCTTCTTCCTGGTGAAGGAAAAAATGAAAGGGAAGAACAAGCTAGTGCCCAGGCTTCTGGGCATCACCAAGGAGTGTGTGATGCGAGTGGATGAGAAGACCAAGGAAGTGATCCAGGAGTGGAACCTCACCAACATCAAACGCTGGGCTGCGTCTCCCAAAAGCTTCACCCTGGATTTTGGAGATTACCAAGATGGCTATTACTCAGTACAGACAACTGAAGGGGAGCAGATTGCACAGCTCATTGCCGGCTACATCGATATCATCCTGAAGAAGAAAAAAAGCAAGGATCACTTTGGGCTGGAAGGAGATGAGGAGTCTACTATGCTGGAGGACTCAGTGTCCCCCAAAAAGTCAACAGTCCTGCAGCAGCAATACAACCGGGTGGGGAAAGTGGAGCATGGCTCTGTGGCCCTGCCTGCCATCATGCGCTCTGGAGCCTCTGGTCCTGAGAATTTCCAGGTGGGCAGCATGCCCCCTGCCCAGCAGCAGATTACCAGCGGCCAGATGCACCGAGGACACATGCCTCCTCTGACTTCAGCCCAGCAGGCACTCACTGGAACCATTAACTCCAGCATGCAGGCCGTGCAGGCTGCCCAGGCCACCCTGGATGACTTTGACACTCTGCCGCCTCTTGGCCAGGATGCTGCCTCTAAGGCCTGGCGTAAAAACAAGATGGATGAATCAAAGCATGAGATCCACTCTCAGGTAGATGCCATCACAGCTGGTACTGCGTCTGTGGTGAACCTGACAGCAGGGGACCCTGCTGAGACAGACTATACCGCAGTGGGCTGTGCAGTCACCACAATCTCCTCCAACCTGACGGAGATGTCCCGTGGGGTGAAGCTGCTGGCTGCCTTGCTGGAGGACGAAGGCGGCAGTGGTCGGCCCCTGTTGCAGGCAGCAAAGGGCCTTGCGGGAGCAGTGTCAGAACTGCTGCGCAGTGCCCAACCAGCCAGTGCTGAGCCCCGTCAGAACCTGCTGCAAGCAGCTGGGAACGTGGGCCAGGCCAGTGGGGAGCTGTTGCAACAAATTGGGGAAAGTGATACTGACCCCCACTTCCAGGATGCGCTAATGCAGCTCGCCAAAGCTGTGGCAAGTGCTGCAGCTGCCCTGGTCCTCAAGGCCAAGAGTGTGGCCCAGCGGACAGAGGACTCGGGACTTCAGACCCAAGTTATTGCTGCAGCAACACAGTGTGCCCTATCCACTTCCCAACTAGTGGCCTGTACTAAGGTGGTGGCACCTACAATCAGCTCACCTGTCTGCCAAGAGCAACTGGTGGAGGCTGGACGACTGGTAGCCAAAGCCGTGGAGGGCTGTGTGTCTGCCTCCCAGGCAGCTACAGAGGATGGGCAACTGTTGCGAGGGGTAGGAGCAGCAGCCACAGCTGTCACCCAGGCCCTAAATGAGCTGCTGCAGCATGTGAAAGCCCATGCCACAGGGGCTGGGCCTGCTGGCCGTTATGACCAGGCTACTGACACCATCCTAACCGTCACTGAGAACATCTTTAGCTCCATGGGTGATGCTGGGGAGATGGTGCGACAGGCCCGCATCCTGGCCCAAGCCACATCTGACCTGGTCAATGCCATCAAGGCTGATGCTGAGGGGGAAAGTGATCTGGAGAACTCCCGCAAGCTCTTAAGTGCTGCCAAGATCCTAGCTGATGCCACAGCCAAGATGGTAGAGGCTGCCAAGGGAGCAGCTGCCCACCCTGACAGTGAGGAGCAGCAGCAGCGGCTGCGGGAGGCAGCTGAGGGGCTGCGCATGGCCACCAATGCAGCTGCGCAGAATGCCATCAAGAAAAAGCTGGTGCAGCGCCTGGAGCATGCAGCCAAGCAGGCTGCAGCCTCAGCCACACAGACCATCGCTGCAGCTCAGCACGCAGCCTCTACCCCCAAGGCCTCTGCCGGCCCCCAGCCCCTGCTGGTGCAGAGCTGCAAGGCAGTGGCAGAGCAGATTCCACTGCTGGTGCAGGGCGTCCGAGGAAGCCAAGCCCAGCCTGACAGCCCCAGCGCTCAGCTTGCCCTCATTGCTGCCAGCCAGAGCTTCCTGCAGCCAGGTGGGAAGATGGTGGCAGCTGCAAAGGCCTCAGTGCCAACGATTCAGGACCAGGCTTCAGCCATGCAGCTGAGTCAGTGTGCCAAGAACCTGGGCACCGCGCTGGCTGAACTCCGGACGGCTGCCCAGAAGGCTCAGGAAGCATGTGGACCTTTGGAGATGGATTCTGCACTGAGTGTGGTACAGAATCTAGAGAAAGATCTACAGGAAGTGAAGGCAGCAGCTCGAGATGGCAAGCTTAAACCCTTACCTGGGGAGACAATGGAGAAGTGTACCCAGGACCTGGGCAACAGCACCAAAGCCGTGAGCTCAGCCATCGCCCAGCTACTGGGAGAGGTTGCCCAGGGCAATGAGAATTATGCAGGTATTGCAGCTCGGGATGTGGCAGGTGGGCTGCGGTCACTGGCCCAGGCCGCTAGGGGAGTCGCTGCACTGACGTCAGATCCTGCAGTGCAGGCCATTGTACTTGATACGGCCAGTGATGTGCTGGACAAGGCCAGCAGCCTCATTGAGGAGGCGAAAAAGGCAGCTGGCCATCCAGGGGACCCTGAGAGCCAGCAGCGGCTTGCCCAGGTGGCTAAAGCAGTGACCCAGGCTCTGAACCGCTGTGTCAGCTGCCTACCTGGCCAGCGCGATGTGGATAATGCCCTGAGGGCAGTTGGAGATGCCAGCAAGCGACTCCTGAGTGACTCGCTTCCTCCTAGCACTGGGACATTTCAAGAAGCTCAGAGCCGGTTGAATGAAGCTGCTGCTGGGCTGAATCAGGCAGCCACAGAACTGGTGCAGGCCTCTCGGGGAACCCCTCAGGACCTGGCTCGAGCCTCAGGCCGATTTGGACAGGACTTCAGCACCTTCCTGGAAGCTGGTGTGGAGATGGCAGGCCAGGCTCCGAGCCAGGAGGACCGAGCCCAAGTTGTGTCCAACTTGAAGGGCATCTCCATGTCTTCAAGCAAACTTCTTCTGGCTGCCAAGGCCCTGTCCACGGACCCTGCTGCCCCTAACCTCAAGAGTCAGCTGGCTGCAGCTGCCAGGGCAGTAACTGACAGCATCAATCAGCTCATCACTATGTGCACCCAGCAGGCACCCGGCCAGAAGGAGTGTGATAACGCCCTGCGGGAATTGGAGACGGTCCGGGAACTCCTGGAGAACCCAGTCCAGCCCATCAATGACATGTCCTACTTTGGTTGCCTGGACAGTGTAATGGAGAACTCAAAGGTGCTGGGCGAGGCCATGACTGGCATCTCCCAAAATGCCAAGAACGGAAACCTGCCAGAGTTTGGAGATGCCATTTCCACAGCCTCAAAGGCACTTTGTGGCTTCACCGAGGCAGCTGCACAGGCTGCATATCTGGTTGGTGTCTCTGACCCCAATAGCCAAGCTGGACAGCAAGGGCTAGTGGAGCCCACACAGTTTGCCCGTGCAAACCAGGCAATTCAGATGGCCTGCCAGAGTTTGGGAGAGCCTGGCTGTACCCAGGCCCAGGTGCTCTCTGCAGCCACCATTGTGGCTAAACACACCTCTGCACTGTGTAACAGCTGTCGCCTGGCTTCTGCCCGTACCACCAATCCTACTGCCAAGCGCCAGTTTGTACAGTCAGCCAAGGAGGTGGCCAACAGCACAGCTAATCTTGTCAAGACCATCAAGGCGCTAGATGGGGCCTTCACAGAGGAGAACCGTGCCCAGTGCCGAGCAGCAACAGCCCCTCTGCTGGAGGCTGTGGACAATCTGAGTGCCTTTGCGTCCAACCCTGAGTTCTCCAGCATTCCTGCCCAGATCAGCCCTGAGGGTCGGGCTGCCATGGAGCCCATTGTGATCTCTGCCAAGACAATGTTAGAGAGTGCCGGGGGACTCATCCAGACAGCCCGGGCCCTCGCAGTCAATCCCCGGGACCCCCCGAGCTGGTCGGTGCTGGCCGGCCACTCCCGTACTGTCTCAGACTCCATCAAGAAGCTAATTACAAGCATGAGGGACAAGGCTCCAGGGCAGCTGGAGTGTGAAACGGCCATTGCAGCTCTGAACAGTTGTCTACGGGACCTAGACCAGGCTTCCCTCGCTGCAGTCAGCCAGCAGCTTGCTCCCCGTGAGGGAATCTCTCAAGAGGCCTTGCACACTCAGATGCTCACTGCAGTCCAAGAGATCTCCCATCTCATTGAGCCGCTGGCCAATGCTGCCCGGGCTGAAGCCTCCCAGCTGGGACACAAGGTGTCCCAGATGGCGCAGTACTTTGAGCCGCTCACCCTGGCTGCAGTGGGTGCTGCCTCCAAGACCCTGAGCCACCCGCAGCAGATGGCACTCCTGGACCAGACTAAAACATTGGCAGAGTCTGCCCTGCAGTTGCTATACACTGCCAAGGAGGCTGGTGGTAACCCAAAGCAAGCAGCTCACACCCAGGAAGCCCTGGAGGAGGCTGTGCAGATGATGACCGAGGCCGTAGAGGACCTGACAACAACCCTCAACGAGGCAGCCAGTGCTGCTGGGGTCGTGGGTGGCATGGTGGACTCCATCACCCAGGCCATCAACCAGCTAGATGAAGGACCAATGGGTGAACCAGAAGGTTCCTTCGTGGATTACCAAACAACTATGGTGCGGACAGCCAAGGCCATTGCAGTGACCGTTCAGGAGATGGTTACCAAGTCAAACACCAGCCCAGAGGAGCTGGGCCCTCTTGCTAACCAGCTGACCAGTGACTATGGCCGTCTGGCCTCGGAGGCCAAGCCTGCAGCGGTGGCTGCTGAAAATGAAGAGATAGGTTCCCATATCAAACACCGGGTACAGGAGCTGGGCCATGGCTGTGCCGCTCTGGTCACCAAGGCAGGCGCCCTGCAGTGCAGCCCCAGTGATGCCTACACCAAGAAGGAGCTCATAGAGTGTGCCCGGAGAGTCTCTGAGAAGGTCTCCCACGTCCTGGCTGCGCTCCAGGCTGGGAATCGTGGCACCCAGGCCTGCATCACAGCAGCCAGCGCTGTGTCTGGTATCATTGCTGACCTCGACACCACCATCATGTTCGCCACTGCTGGCACGCTCAATCGTGAGGGTACTGAAACTTTCGCTGACCACCGGGAGGGCATCCTGAAGACTGCGAAGGTGCTGGTGGAGGACACCAAGGTCCTGGTGCAAAACGCAGCTGGGAGCCAGGAGAAGTTGGCGCAGGCTGCCCAGTCCTCCGTGGCGACCATCACCCGCCTCGCTGATGTGGTCAAGCTGGGTGCAGCCAGCCTGGGAGCTGAGGACCCTGAGACCCAGGTGGTACTAATCAACGCAGTGAAAGATGTAGCCAAAGCCCTGGGAGACCTCATCAGTGCAACGAAGGCTGCAGCTGGCAAAGTTGGAGATGACCCTGCTGTGTGGCAGCTAAAGAACTCTGCCAAGGTGATGGTGACCAATGTGACATCATTGCTTAAGACAGTAAAAGCCGTGGAAGATGAGGCCACCAAAGGCACTCGGGCCCTGGAGGCAACCACAGAACACATACGGCAGGAGCTGGCGGTTTTCTGTTCCCCAGAGCCACCTGCCAAGACCTCTACCCCAGAAGACTTCATCCGAATGACCAAGGGTATCACCATGGCAACCGCCAAGGCCGTTGCTGCTGGCAATTCCTGTCGCCAGGAAGATGTCATTGCCACAGCCAATCTGAGCCGCCGTGCTATTGCAGATATGCTTCGGGCTTGCAAGGAAGCAGCTTACCACCCAGAAGTGGCCCCTGATGTGCGGCTTCGAGCCCTGCACTATGGCCGGGAGTGTGCCAATGGCTACCTGGAACTGCTGGACCATGTACTGCTGACCCTGCAGAAGCCAAGCCCAGAACTGAAGCAGCAGTTGACAGGACATTCAAAGCGTGTGGCTGGTTCCGTCACTGAGCTCATCCAGGCTGCTGAAGCCATGAAGGGAACAGAATGGGTAGACCCAGAGGACCCCACAGTCATTGCTGAGAATGAGCTCCTGGGAGCTGCAGCCGCCATTGAGGCTGCAGCCAAAAAGCTAGAGCAGCTGAAGCCCCGGGCCAAACCCAAGGAGGCAGATGAGTCCTTGAACTTTGAGGAGCAGATACTAGAAGCTGCCAAGTCCATTGCAGCAGCCACCAGTGCACTGGTAAAGGCTGCGTCGGCTGCCCAGAGAGAACTAGTGGCCCAAGGGAAGGTGGGTGCCATTCCAGCCAATGCACTGGACGATGGGCAGTGGTCCCAGGGCCTCATTTCTGCTGCCCGGATGGTGGCTGCGGCCACCAACAATCTGTGTGAGGCAGCCAATGCAGCTGTACAAGGCCATGCCAGCCAGGAGAAGCTCATCTCATCAGCCAAGCAGGTAGCTGCCTCCACAGCCCAGCTCCTTGTGGCCTGCAAGGTCAAGGCTGACCAGGACTCGGAGGCAATGAAACGACTTCAGGCTGCTGGCAACGCAGTGAAGCGAGCCTCAGATAATCTGGTGAAAGCAGCACAGAAGGCTGCAGCCTTTGAAGAGCAGGAGAATGAGACAGTGGTGGTGAAAGAGAAGATGGTTGGCGGCATTGCCCAGATCATCGCAGCACAGGAAGAAATGCTTCGGAAGGAACGAGAGCTGGAAGAGGCGCGGAAGAAACTGGCCCAGATCCGGCAGCAGCAGTACAAGTTTCTGCCTTCAGAGCTTCGAGATGAGCACTAAAGAAGCCTCTTCTATTTAATGCAGACCCGGCCCAGAGACTGTGCGTGCCACTACCAAAGCCTTCTGGGCTGTCGGGGCCCAACCTGCCCAACCCCAGCACTCCCCAAAGTGCCTGCCAAACCCCAGGGCCTGGCCCCGCCCAGTCCCGCAGTACATCCCCTGTCCCCTCCCCAACCCCAAGTGCCTTCATGCCCTAGGGCCCCCCAAGTGCCTGCCCCTCCCCAGAGTATTAACGCTCCAAGAGTATTATTAACGCTGCTGTACCTCGATCTGAATCTGCCGGGGCCCCAGCCCACTCCACCCTGCCAGCAGCTTCCGGCCAGTCCCCACAGCCTCATCAGCTCTCTTCACCGTTTTTTGATACTATCTTCCCCCACCCCCAGCTACCCATAGGGGCTGCAGAGTTATAAGCCCCAAACAGGTCATGCTCCAATAAAAATGATTCTACCTACAACCTCTGCCTGGCTTCAAGGGAGATACAAGTTTTCTCCCAGGGCAGTAGGAGAGACAGTGGGGTTGAATTCTGTCACCCAGCTTGATCCAGCTTGAAATGGGAGAGGGGAAGACTGGCAGTCTGCACCTGAGGTCCCTTCCTCCTTGCACCCGGACCCTAAAGTTATCCAATGGGGAAGTTGTGCCTGAGAAGTCATACTCCTGTTATCCTCACCTCCCTGGCCAGCACCTAAGCCTCACAAAGTGTCGTTCTGCTGCTGCTGGGACAGCAGCTACCACAGTTCCTTGTGGCTACCAGGACATTCTGTTCTTCATAGCTACTCAGGGTATGTCAACAAATCCAGTCCTTGACCAAATTCAAATTTTCAAAAGAAGCTTTGCTAAAAATAATATGCCTGTAAGTGTCTGAGCCTAAGAGAACTATGGCCACAAAACTGATTGAAGCCATTAGCAAGCAGAAAAATCCCAACTTGAGGCTGCCTCGGGTAGGCACCGCTCTTGATTGGGTTGGGACACTCCTGCCTAGGGTAGCGCTAAAAGTGAAGAGCTTGACCCAGGTGTGAGAATTTATTGTTAGAGGGGGCAGAGCTCCCCTAGTGGCCAGGAAGGTGCTAGCAGCCCTGTTCCAGCCACCCTGCTTATCTGGTGGGTCAGTGGAAAGAGGCAGTCAGAGAGGTGGATGCTGTGTGCTTCCACGTCCCCATCCAGCCACTCTGTCCATAATGCATGGACTCTCTGACAGTCGTCTTAGGTTGGCAACTATTTTCATGCGTGATTCTTTAGTCAGCCCTACCGCCCAGTACATTATTTCCTCAAGTAGAACACAAACGCCACCCATCTGCTACTAACACCTTCTACTCCCACCACATTAGGGAAAGCTTGAAGTAGATGGAATGTAGCTGGTAACGGTGGTTCGAGCCTCTAATCCCAGCTACTTAAAAGGCTGAGGCAGGAGGACTGCTTGAGACCAGGAGTTCAAGACCAGCCTGGGCAA