Transcript asmbl_134409

Sequence
Transcript Sequence for observation asmbl_134409 of TGE0056977:
CAGTGGGTGGGCGAAGGGGGCGGCCGCACCCCCCGGCCGGGCCGTGCTTCTGCCCCTACAAGGTTTGGGCCGAGGTGGGGGAGGGTCCTGGTTGCCGGCCCCGCCCGGTCCCTCCCCGCCTTTTAGGCGCCCGCGTGGCCGGGACGTCCCAGTCCCGCTCCGTCCTCCTCGCCTGCCACCGGTGCACCCAGTCCGCTCACCCAGCCCAGTCCGTCCGGTCCTCACCGCCTGCCGGCCGGCCCACCCCCCACCGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTGAAGCTGGACAAGGAGAACGCCATCGACCGCGCCGAGCAGGCCGAAGCCGACAAGAAGCAAGCTGAGGACCGCTGCAAGCAGCTGGAGGAGGAGCAGCAGGCCCTCCAGAAGAAGCTGAAGGGGACAGAGGATGAGGTGGAAAAGTATTCTGAATCCGTGAAGGAGGCCCAGGAGAAACTGGAGCAGGCCGAGAAGAAGGCCACTGATGCTGAGGCAGATGTGGCCTCCCTGAACCGCCGCATTCAGCTGGTTGAGGAGGAGCTGGACCGGGCCCAGGAGCGCCTGGCTACAGCCCTGCAGAAGCTGGAGGAGGCCGAGAAGGCGGCTGATGAGAGCGAGAGAGGAATGAAGGTCATCGAAAACCGGGCCATGAAGGATGAGGAGAAGATGGAACTGCAGGAGATG