Transcript asmbl_133923

Sequence
Transcript Sequence for observation asmbl_133923 of TGE0056458:
GCGCTCCCCCACCCCTCGCGCAGCGCCGGGGCGCTTCCCCCGGCGCTCGCGCCCGCCCGCCGCGGGAGCGCGCGTAGCCGCTTATAAAAGAGGCGGGGCGCGCGCGTCGCCGCCACTACCCGCTGCGGAGTGAACGGTGTGGAGCGGAGGCCGCGGAGGCTCCTCGGTCCTTCAGCACCCCTCGGCCCGACGCACCCACGCCCCTCACCCCCCGAGAGCCGAAAATGGACCCAAGTGGGGTCAAAGTGCTGGAAACAGCAGAGGACATCCAGGAGAGGCGGCAGCAGGTCCTAGACCGATACCACCGCTTCAAGGAACTCTCAACCCTTAGGCGTCAGAAGCTGGAAGATTCCTATCGATTCCAGTTCTTTCAAAGAGATGCTGAAGAGCTGGAGAAATGGATACAGGAAAAACTTCAGATTGCATCTGATGAGAATTATAAAGACCCAACCAACTTGCAGGGAAAGCTTCAGAAGCATCAAGCATTTGAAGCTGAAGTGCAGGCCAACTCAGGAGCCATTGTTAAGCTGGATGAAACTGGAAACCTGATGATCTCAGAAGGGCATTTTGCATCTGAAACCATACGGACCCGTTTGATGGAGCTGCACCGCCAGTGGGAATTACTTTTGGAGAAGATGCGAGAAAAAGGAATCAAACTGCTGCAGGCCCAGAAGTTGGTGCAGTACTTACGAGAATGTGAGGACGTGATGGACTGGATCAATGACAAGGAAGCAATTGTTACTTCTGAAGAGCTGGGCCAGGATCTGGAGCATGTAGAGGTTTTACAGAAGAAATTTGAAGAGTTTCAAACAGATATGGCTGCTCATGAAGAAAGAGTTAATGAAGTGAACCAGTTTGCTGCCAAACTCATACAGGAGCAGCACCCTGAGGAGGAACTGATCAAGACTAAGCAGGATGAAGTCAATGCAGCCTGGCAGCGGCTGAAGGGCCTGGCTCTGCAGAGGCAGGGGAAGCTCTTTGGGGCAGCAGAAGTTCAGCGCTTTAACAGGGATGTGGATGAGACTATCAGTTGGATTAAGGAAAAGGAGCAGTTAATGGCCTCTGATGATTTTGGCCGAGACCTGGCAAGTGTTCAGGCTCTGCTTCGGAAGCACGAGGGTCTGGAGAGAGATCTTGCTGCTCTAGAAGACAAGGTCAAAGCCCTGTGTGCTGAGGCTGACCGCCTGCAACAGTCCCACCCTCTGAGTGCAACACAGATTCAAGTGAAGCGAGAGGAACTGATTACAAACTGGGAGCAGATCCGCACCTTGGCGGCAGAGAGACATGCACGGCTCAATGATTCATACAGGCTTCAACGCTTCCTTGCTGACTTCCGTGACCTCACCAGCTGGGTGACTGAGATGAAAGCCCTCATCAATGCAGATGAGCTTGCCAGTGATGTGGCTGGGGCTGAAGCCCTGCTAGATAGACACCAAGAGCACAAGGGTGAAATTGATGCCCATGAAGACAGCTTCAAATCTGCAGATGAATCTGGACAGGCACTGCTTGCTGCTGGTCACTATGCCTCAGATGAAGTGAGGGAGAAGCTGACCGTCCTTTCCGAGGAGAGAGCGGCGCTGCTGGAGCTGTGGGAGCTGCGCAGGCAGCAGTACGAGCAGTGCATGGACCTGCAGCTCTTCTACCGGGACACTGAGCAGGTGGACAACTGGATGAGCAAGCAGGAGGCGTTCCTGTTGAATGAAGACTTGGGAGATTCCTTGGATAGTGTGGAAGCGCTTCTTAAGAAGCACGAAGACTTTGAGAAATCCCTTAGTGCCCAGGAGGAAAAGATTACAGCATTAGATGAATTTGCAACCAAGCTAATTCAGAACAACCACTATGCAATGGAAGATGTGGCCACTCGCCGAGATGCTCTGTTGAGCCGCCGCAATGCCCTTCACGAGAGAGCCATGCGTCGCCGGGCCCAGCTAGCCGATTCTTTCCATCTGCAGCAGTTTTTCCGTGATTCTGATGAGCTCAAGAGTTGGGTCAATGAGAAGATGAAAACTGCCACAGATGAAGCTTATAAAGATCCATCCAACCTACAAGGAAAAGTACAGAAGCATCAGGCTTTTGAGGCTGAGCTCTCAGCAAACCAGAGCCGAATTGATGCCTTGGAGAAAGCTGGCCAAAAGCTGATTGATGTCAACCACTATGCCAAGGATGAAGTGGCAGCTCGTATGAATGAGGTGATCAGTTTGTGGAAGAAACTGCTAGAGGCCACTGAACTGAAAGGAATAAAGCTTCGTGAAGCCAACCAGCAACAGCAATTTAATCGCAATGTTGAGGATATTGAATTGTGGCTATATGAAGTAGAAGGTCACTTGGCTTCGGATGATTACGGCAAAGATCTTACCAATGTGCAGAACCTCCAGAAGAAACATGCACTGCTAGAGGCAGATGTGGCTGCTCACCAGGACCGAATTGATGGCATCACCATTCAGGCCCGCCAGTTCCAAGATGCTGGCCATTTTGATGCAGAAAACATCAAGAAGAAACAGGAAGCCCTCGTGGCTCGCTATGAGGCACTCAAGGAGCCCATGGTTGCCCGGAAGCAGAAGCTGGCCGATTCTCTGCGGTTGCAGCAGCTCTTCCGGGATGTTGAGGATGAGGAGACGTGGATTCGAGAGAAAGAGCCCATTGCCGCATCTACCAACAGAGGTAAGGATTTAATTGGGGTCCAGAATCTGCTAAAGAAACATCAAGCCTTACAAGCAGAAATTGCTGGACATGAACCACGCATCAAAGCAGTTACACAGAAGGGGAATGCCATGGTGGAGGAAGGCCATTTTGCTGCAGAGGATGTGAAGGCCAAGCTTCACGAGCTGAACCAAAAGTGGGAGGCACTGAAAGCCAAAGCTTCCCAGCGTCGGCAGGACCTGGAGGACTCTCTGCAGGCCCAGCAGTACTTTGCTGATGCTAACGAGGCTGAATCCTGGATGCGGGAGAAGGAACCCATTGTGGGCAGCACTGACTATGGCAAGGACGAAGACTCTGCTGAGGCTCTACTGAAGAAACACGAAGCTTTGATGTCAGATCTCAGTGCCTACGGCAGCAGCATCCAGGCTTTGCGAGAACAAGCACAGTCCTGCCGGCAACAAGTGGCCCCCACGGATGATGAGACTGGGAAGGAGCTGGTCTTGGCTCTCTACGACTATCAGGAGAAGAGTCCCCGAGAGGTCACCATGAAGAAGGGAGATATCCTTACCTTACTCAACAGCACCAACAAGGATTGGTGGAAAGTGGAAGTGAACGATCGTCAGGGTTTTGTGCCGGCTGCGTACGTGAAGAAATTGGACCCCGCCCAGTCAGCCTCCCGGGAGAATCTCCTGGAGGAGCAAGGCAGCATAGCACTGCGGCAGGAGCAGATTGACAATCAGACACGCATAACTAAGGAGGCCGGCAGTGTATCTCTGCGTATGAAGCAGGTGGAAGAACTATATCATTCTCTGCTGGAACTGGGTGAGAAGCGTAAAGGCATGTTGGAGAAGAGTTGCAAGAAGTTTATGTTGTTCCGTGAAGCGAATGAACTACAGCAATGGATCAATGAGAAGGAAGCCGCTCTGACAAGTGAGGAGGTCGGAGCAGACTTGGAGCAGGTTGAGGTGCTCCAGAAGAAGTTTGATGACTTCCAGAAGGACCTGAAGGCCAATGAGTCACGGTTGAAGGACATTAACAAGGTAGCTGAAGACCTGGAGTCTGAAGGTCTCATGGCAGAGGAGGTGCAGGCTGTGCAACAACAGGAAGTGTATGGCATGATGCCCAGGGATGAAACTGATTCCAAGACAGCCTCCCCGTGGAAGTCTGCTCGTCTGATGGTTCACACCGTGGCCACCTTTAATTCCATCAAGGAGCTGAATGAGCGCTGGCGGTCCCTACAGCAGCTGGCCGAGGAACGGAGCCAGCTCTTGGGCAGCGCCCATGAAGTACAGAGGTTCCACAGAGATGCTGATGAAACCAAAGAATGGATTGAAGAGAAGAATCAAGCTCTAAACACAGACAATTATGGACATGATCTCGCCAGTGTCCAGGCCCTGCAACGCAAGCATGAGGGCTTCGAGAGGGACCTTGCGGCTCTCGGTGACAAGGTAAACTCCCTTGGTGAAACAGCAGAGCGCCTGATCCAGTCCCATCCCGAGTCAGCAGAAGACCTGCAGGAAAAGTGCACAGAGTTAAACCAGGCCTGGAGCAGCCTGGGGAAACGTGCAGATCAGCGCAAGGCAAAGTTGGGTGACTCCCACGACCTGCAGCGCTTCCTTAGCGATTTCCGGGACCTCATGTCTTGGATCAATGGAATACGGGGGTTGGTGTCCTCAGATGAGCTAGCCAAGGATGTCACCGGAGCTGAGGCATTGCTGGAGCGACACCAGGAACACCGGACAGAAATCGATGCCAGGGCTGGCACTTTCCAGGCATTTGAGCAGTTTGGACAGCAGCTGTTGGCTCACGGACACTATGCCAGCCCTGAGATCAAGCAGAAACTTGATATTCTTGACCAGGAGCGTGCAGACCTGGAGAAGGCCTGGGTTCAGCGCAGGATGATGCTGGATCAGTGCCTTGAACTGCAGCTGTTCCATCGGGACTGTGAGCAAGCTGAGAACTGGATGGCTGCCCGGGAGGCCTTCTTGAATACCGAAGACAAAGGAGACTCACTGGACAGCGTAGAGGCTCTGATCAAAAAACATGAAGACTTTGACAAAGCGATTAACGTCCAGGAAGAGAAGATTGCTGCTCTGCAGGCCTTTGCCGACCAGCTCATCGCTGCCGGCCATTATGCCAAGGGAGACATTTCTAGCCGGCGCAATGAGGTCTTGGACAGGTGGCGACGTCTGAAAGCCCAGATGATTGAGAAAAGGTCAAAGCTAGGAGAATCTCAAACCCTCCAACAGTTCAGCCGGGATGTGGATGAGATTGAGGCTTGGATCAGTGAAAAATTGCAAACAGCGAGTGATGAGTCGTACAAGGATCCCACCAACATCCAGAGCAAGCACCAGAAGCACCAGGCTTTTGAAGCAGAGCTGCATGCCAACGCTGACCGGATCCGTGGGGTTATCGACATGGGCAACTCCCTCATTGAACGTGGAGCCTGTGCCGGCAGTGAGGATGCTGTCAAGGCCCGCCTGGCTGCCTTAGCTGACCAGTGGCAGTTCTTGGTGCAAAAGTCAGCGGAAAAGAGCCAGAAACTGAAAGAAGCCAACAAGCAGCAGAACTTCAACACAGGGATCAAGGACTTTGACTTCTGGCTGTCTGAGGTGGAGGCCCTGCTGGCATCCGAAGATTATGGCAAAGACCTAGCTTCTGTGAACAACCTGCTGAAAAAGCATCAACTGCTGGAAGCAGATATATCTGCCCATGAGGATCGCCTGAAGGACCTGAACAGCCAGGCAGACAGCCTGATGACCAGCAGTGCCTTCGACACCTCCCAAGTAAAGGACAAGAGGGACACCATCAACGGGCGCTTCCAGAAGATCAAGAGCATGGCGGCCTCCCGGCGAGCCAAGCTGAATGAATCCCATCGCCTGCACCAGTTCTTCCGGGACATGGATGACGAGGAGTCCTGGATCAAGGAGAAGAAGCTGCTGGTGGGCTCAGAGGACTACGGCCGGGACCTAACCGGCGTGCAGAACCTGAGGAAGAAGCACAAGCGGCTGGAAGCAGAACTGGCTGCGCATGAGCCGGCTATTCAGGGTGTCCTGGACACTGGCAAGAAGCTGTCCGATGACAACACCATCGGGAAAGAGGAGATCCAGCAGCGGCTGGCGCAGTTTGTGGAGCACTGGAAAGAGCTGAAGCAGCTGGCAGCTGCCCGGGGTCAGCGGCTGGAAGAGTCCTTGGAATATCAGCAGTTTGTAGCCAATGTGGAAGAGGAAGAAGCCTGGATCAATGAGAAAATGACCCTGGTGGCCAGCGAAGATTATGGCGACACTCTTGCCGCCATCCAGGGCTTACTGAAGAAACATGAAGCTTTTGAGACAGACTTCACCGTCCACAAGGATCGCGTGAATGATGTCTGCACCAATGGACAAGACCTCATTAAGAAGAACAATCACCATGAGGAGAACATCTCTTCAAAGATGAAGGGCCTGAACGGGAAAGTGTCAGACCTGGAGAAAGCTGCAGCCCAGAGAAAGGCGAAGCTGGATGAGAACTCGGCCTTCCTTCAGTTCAACTGGAAGGCGGACGTGGTGGAGTCCTGGATCGGTGAAAAGGAGAACAGCTTGAAGACAGATGATTATGGCCGAGACCTGTCTTCTGTGCAGACGCTCCTCACCAAACAGGAAACTTTTGACGCTGGGCTGCAGGCCTTCCAGCAGGAAGGCATTGCCAACATCACTGCCCTCAAAGATCAGCTTCTCGCCGCCAAACACGTTCAGTCCAAGGCCATCGAGGCCCGGCACGCCTCCCTCATGAAGAGGTGGAGCCAGCTTCTGGCCAACTCAGCCGCCCGCAAGAAGAAGCTTCTGGAGGCTCAGAGTCACTTCCGCAAGGTGGAGGACCTCTTCCTGACCTTCGCCAAAAAGGCTTCTGCCTTCAACAGCTGGTTTGAAAATGCAGAGGAGGACTTAACAGACCCCGTGCGCTGCAACTCCTTGGAAGAAATCAAAGCTTTGCGCGAGGCCCACGACGCCTTCCGCTCCTCCCTCAGCTCTGCCCAGGCTGACTTCAACCAGCTGGCCGAGCTGGACCGCCAGATCAAGAGCTTCCGCGTAGCCTCCAACCCCTACACCTGGTTTACCATGGAGGCCCTGGAGGAGACCTGGAGGAACCTACAGAAAATCATCAAGGAGAGGGAGCTGGAGCTGCAGAAGGAACAGCGGCGGCAGGAGGAGAACGACAAGCTGCGCCAGGAGTTTGCCCAGCACGCCAACGCCTTCCACCAGTGGATCCAAGAGACCAGGACATACCTCCTCGATGGGTCCTGTATGGTGGAAGAGTCGGGGACCCTCGAATCCCAGCTTGAAGCTACCAAACGCAAGCACCAGGAAATCCGAGCCATGAGAAGTCAGCTCAAAAAGATCGAGGACCTGGGGGCCGCCATGGAGGAGGCCCTCATCCTGGACAACAAGTACACGGAGCACAGCACCGTGGGCCTCGCCCAGCAGTGGGACCAGCTGGACCAGCTGGGCATGCGCATGCAGCACAACCTGGAGCAGCAGATCCAGGCCAGGAACACAACAGGTGTGACTGAGGAGGCCCTCAAAGAATTCAGCATGATGTTTAAACACTTTGACAAGGACAAGTCTGGCAGGCTGAACCATCAGGAGTTCAAATCTTGCCTGCGCTCCCTGGGCTATGACCTGCCCATGGTGGAGGAAGGGGAACCTGACCCTGAGTTCGAGGCAATCCTGGACACGGTGGATCCGAACAGAGATGGCCATGTCTCCTTGCAAGAATACATGGCTTTCATGATCAGCCGCGAAACTGAGAACGTCAAGTCCAGCGAGGAGATTGAGAGCGCCTTCCGGGCCCTCAGCTCAGAGGGAAAGCCTTACGTGACCAAGGAGGAGCTCTACCAGAACCTGACCCGGGAACAAGCCGACTACTGCGTCTCCCACATGAAGCCCTACGTGGACGGCAAGGGCCGCGAGCTCCCCACCGCGTTCGACTACGTGGAGTTCACCCGCTCGCTTTTCGTGAACTGAGCCACTCCCTGGGTCACCCACCCCTCGCTGCTTGCCCTGCGTCGCCTTGCTGCATGTCCGCTCCTCTGTGTGCTCTCACTTTCCACTGTAACCTTAAGCCTGCTTAGCTTGGAATAAGACTTAGGAGAAAATGGTGCTTCACTAACCCGCTTCCGGTCCAGTCACAATCATCATGTCACTGTGGGGACCCAGATCTGTGTCTTGAAGCAGCTGCCCTCATTCCGACTTCAGAAAATCGAAGCAGCTGGCTCCTCCCCTTGTTCTCTCTCCCACCCTCCCCCAAATCTGTTTTCATGTAAAAGACAAATAAATGATGACTTCCCCC