Transcript asmbl_133520

Sequence
Transcript Sequence for observation asmbl_133520 of TGE0056971:
TTTAAAAAAACAAACAAACAAAAAGAAACCCATTAATGTTTTCCCAAAGCTTTGTGGACACATTGAAGCTTCTTGTTTCAGCTTCTGCCAACATTTCTCGCTCCAGCAAACTTTCTTCTGCTTCCCAAATATGACAAGCTTCTTCTTTAACTTTTCTGCCAGGTTAATCTTGACTCATTTCAAGAGAGGCTTGGGTCAGCCAGGGCCTACTCTAAGAAGTTTCTTTAGCCCTTATGTTTTCCTATGGAGAGCACACACTAGCTTTAAGTCCTGAGGGTACTTAAGATGATATTTCAATGTTTTTGTACTCTTAGTGCTTGGCATATGGTGGGTGGTCTACAAATTTAGAACAATGTAGTGAACCACAAACTCCTCTCTTCAGCCTGTGTGCTTACTTGTAGTAGTTGTCTGATCTCTAAAATTTAGAACTGAATATGCCAAGAAAGAGTTCAATTTCAGAGAGGAGGGTATGGTTTCATTTTAAGTATAAAAGCTTCCTTTAAAAAAAATTACGTCTTACATTTTGTTATGCTCCTAAGTGTAATTGATCCTGGAAAGTAAGCGCAAGGCTACTCTCTAATGCTAACTCTTATGTATGTAAGAGGTGAGGAAGGAGAGGTTGTGTGTGGTGCATTTGTTTTGTAAAAGCATCTAACTGTTTTCTTTCCAGACACTTTTTCAAAAATGGCAATGGTATCAGAATTCCTCAAGCAGGCCTGGTTTATTGAAAATGAAGAGCAGGAATATGTTCAAACTGTGAAGTCATCCAAAGGTGGTCCCGGATCAGCGGTGAGCCCCTATCCTACCTTCAATCCATCCTCGGATGTCGCTGCCTTGCATAAGGCCATAATGGTTAAAGGTGTGGATGAAGCAACCATCATTGACATTCTAACTAAGCGAAACAATGCACAGCGTCAACAGATCAAAGCAGCATATCTCCAGGAAACAGGAAAGCCCCTGGATGAAACACTGAAGAAAGCCCTTACAGGTCACCTTGAGGAGGTTGTTTTAGCTCTGCTAAAAACTCCAGCGCAATTTGATGCTGATGAACTTCGTGCTGCCATGAAGGGCCTTGGAACTGATGAAGATACTCTAATTGAGATTTTGGCATCAAGAACTAACAAAGAAATCAGAGACATTAACAGGGTCTACAGAGAGGAACTGAAGAGAGATCTGGCCAAAGACATAACCTCAGACACATCTGGAGATTTTCGGAACGCTTTGCTTTCTCTTGCTAAGGGTGACCGATCTGAGGACTTTGGTGTGAATGAAGACTTGGCTGATTCAGATGCCAGGGCCTTGTATGAAGCAGGAGAAAGGAGAAAGGGGACAGACGTAAACGTGTTCAATACCATCCTTACCACCAGAAGCTATCCACAACTTCGCAGAGTGTTTCAGAAATACACCAAGTACAGTAAGCATGACATGAACAAAGTTCTGGACCTGGAGTTGAAAGGTGACATTGAGAAATGCCTCACAGCTATCGGTATGTAGTCCAGCAGTTGAAAGAGTTTTCTAACTAGAAATTGTATTTTCAAAGCTATCCTATACTTAACAAGAACAACAGCAACAAAACCAATAAAAGAAAACAAAAAACAATCAGAAGTAGTGCATCTGTTTCAATTGAAGCAACGTAAAAGATTGGCAAAGTACTATAACCTTAATAACAATAGATATTATTCCCCTTTTCAAAAATAGAGAGAGATAGACTATACTTATTGAGCACCTACTTATATCAAACAATGTACCAGGCTGGGCACACCACAGAGGCAATTCAGAATGGTCACTGAGAGCATGGGATCTGGAATAAATGTAACATCTGGATAAATGTAACTTCAAGTCCTGGTCTACTGCTTGTTAATTGTACAATCTTGGGCAGGTCCAGGAGAGTCTGATTCAGTGGGTCCGAGTTGGCCTCTAAAAATCGGTACTTTTTAAAGATCTCCCAGGTTATTCAGACAACCATCAGGGTTGGGGAACCTATGTTCTCAAGCAGTGTTTCTCATTCATGACTATGCACTTGAATCCCCTGGAAAGCTTGTTAAAATGCAGATTCTGATTCCCCAGGTCTGGGGTGGAGCTTAGATTCTGCTTTTCTAACAAGCTCCCCATTGATGCCAATGCTGTTGGTCCATAGATCTCGACAAGATGAAGAACACTATGAACTGGAATGTGCTAGTATTATTTGGGTTCTGTTTTATATTTAAGCCCATCCTATCCCAGAGTTTTTTCTTCATTTATTCATTTATTTTTACTTATTTGTTTGTGCAACTCTTACTTTAGACACAGAGGTACATGTGCACGTTTGTTCCATGGGTGTTCTGCACTCAGGCAGTGAGCATAGTACCCAATAAGTAGTTTTTTGACCAATGCCCCTTCTCTCCCTGCCCTCTCTAGTAGTCTGCAGTGTCTGTTGTTCATAGGGTGTTCTTTTTAAATGTTCTTATAGTAACATAAATAAAGTATTTACATAGGCTTGAACACCTAGTGGCTTCTCCACTCCCAAGGAGAATATATGTTGGATAGCGCAAACTACTGAAGTTGCTCTTGAGATGTATTTAAGGTAATAAAAAAATTGATCGTCAGGGAAAAGAATATTCAAAACCACCATCTAGAGAGTCACAAATACCTTCTCAGAAGTTAACTGCCCTATATTGGGAGATGAGAGGTGAAGAATGATGATGAGGGATAGAACACTGTTGGCAAAATTCTATATTTCCTGTTTCTTTCATATGGATATTTCATTTTTTTCATGGTAAATACATCAACTAAAATTTTCTTCTCTAACAGTGAAGTGCGCCACAAGCAAACCAGCTTTCTTTGCAGAGAAGCTTCATCAAGCCATGAAAGTATGTACCATTCTACTTATATGTCCTGCTTAGAGGAAGAATTATTTGTAGAAAGAACAGAAAACCTCATGTTGTTTGAAAATCTCACATTTAATATCTTCCCATTAATGAGAATCATTGTTCTATTTGATGAAAGAGGTAATACACTACCTTCTCAGAATAAACTTCTGTTAGATTCGGTGCTTTTTTTTACAGATGAGATTGTAAAGTGAGCCTGTAAGTGATTTACGGCTCACTTGTGATTTGCTTAAAACATGTGTCACCACGGGAAGGGTGATGTACTTTCTTTTTTAACGTGTAATTTTAGTGGCCTACTTCCTCTAAGGTTGTGAGTTTTATAATCTCCCACTTTATGAGTCTGATTTGTTGTTTTTATTATTCTGTCTTTTATGCCACAGATTAATAGTTGAAACTTTTGAAATGTCATTCTATGATTAAGGATGTAGAATGATGTATTTGAGATCAACTATGTCACTTTAACTTTACTGTCTGACATGCATGGTATTATACAAGGTACCTCTTCTATTCTGACATTTTGAGCCCACAAATGAATAGTTATGAAGTTATCTTCCTTTTTTCTTTGCAGCTCCAAAATAAGGAGGTTTTCAGAGAGAGAGAGAAAGAAAGATCTAACTATTTGAATAATATGAAGGAATATTTTGAATATATATGAATAATTTGAATAATATGAAATGATAGACATGCTAGGTACTGCTCTGTAGTGGTTAGCATAGTTGCTGCCCCCTTTCTGCCATAGTCTAGTGTGATATTTCGTTGGGTAATGATGAATACCTGGTGCCATGGAAGAGAAAAGTGGGACATATACTCCAGACTTTGGAAATCCAGGTAGCATTGCTGTCAGCTAAATTAACACCTGAAGTTTAAATAGAAATGAGCCAGATGAGGGCAAGAGTGGAAGAGATGGGGATAAAGCAAGGGTGGTCCAAGAGGAAGAAGTAACCCACACACAGGCTTGAAGGCAAAAGGTAACATAACCTTCTCAAGACAGTAAGTATAGAGTGATGGTGCACACTGGAAGAGATGGTAGAATTAGGCAGGATATTGTAAGCCTTGAAAAAGAATTAGGCAGGATATCGGAAGCCCTGATTAGATTCTATCCTAAGAGCAACAGAAGATCACTGACAGTGTTTTAAATAGATAGACTAGTTTATTAGATTTGCAGTTTAGAAGTTCCCTTTTTTTGTAATTATTGGACAGTGTAGAGACCGGATGGTGAGAGATGAGTTAGGAAGTTGTGACAGCTCTCTATACCTACCGCTAATGTAGAGGATTATTTATTTTCATTTCATTACCATTCGTGTAAGGTGTGTGTGTGTGTGTGTGTG