Transcript asmbl_133519

Sequence
Transcript Sequence for observation asmbl_133519 of TGE0056452:
CATAGCTGAGCCATGTACTTCAAACAGAAGGCAGCCAATTACTAACTTCTGGTTGCTAGGTGTGGCTTCCTTTAAAATCCTATAAAATCAGAAGCCCAAGTCTCCACTGCCAGTGTGAAATCTTCAGAGAAGAATTTCTCTTTAGTTCTTTGCAAGAAGGTAGAGATAAAGACACTTTTTCAAAAATGGCAATGGTATCAGAATTCCTCAAGCAGGCCTGGTTTATTGAAAATGAAGAGCAGGAATATGTTCAAACTGTGAAGTCATCCAAAGGTGGTCCCGGATCAGCGGTGAGCCCCTATCCTACCTTCAATCCATCCTCGGATGTCGCTGCCTTGCATAAGGCCATAATGGTTAAAGGTGTGGATGAAGCAACCATCATTGACATTCTAACTAAGCGAAACAATGCACAGCGTCAACAGATCAAAGCAGCATATCTCCAGGAAACAGGAAAGCCCCTGGATGAAACACTGAAGAAAGCCCTTACAGGTCACCTTGAGGAGGTTGTTTTAGCTCTGCTAAAAACTCCAGCGCAATTTGATGCTGATGAACTTCGTGCTGCCATGAAGGGCCTTGGAACTGATGAAGATACTCTAATTGAGATTTTGGCATCAAGAACTAACAAAGAAATCAGAGACATTAACAGGGTCTACAGAGAGGAACTGAAGAGAGATCTGGCCAAAGACATAACCTCAGACACATCTGGAGATTTTCGGAACGCTTTGCTTTCTCTTGCTAAGGGTGACCGATCTGAGGACTTTGGTGTGAATGAAGACTTGGCTGATTCAGATGCCAGGGCCTTGTATGAAGCAGGAGAAAGGAGAAAGGGGACAGACGTAAACGTGTTCAATACCATCCTTACCACCAGAAGCTATCCACAACTTCGCAGAGTGTTTCAGAAATACACCAAGTACAGTAAGCATGACATGAACAAAGTTCTGGACCTGGAGTTGAAAGGTGACATTGAGAAATGCCTCACAGCTATCGTGAAGTGCGCCACAAGCAAACCAGCTTTCTTTGCAGAGAAGCTTCATCAAGCCATGAAAGGTGTTGGAACTCGCCATAAGGCATTGATCAGGATTATGGTTTCCCGTTCTGAAATTGACATGAATGATATCAAAGCATTCTATCAGAAGATGTATGGTATCTCCCTTTGCCAAGCCATCCTGGTATGTTTTGATTCCTCTAATGCCATCCCAACAAATGAAAGTTCTTTTTGCAAGATCTTCAAGGAGAAGAGTTGACTTATTGTATCTATAAATTTAATATGTAAGATTAATTTAATATATTATGGTGTATACTTCATGAGTAAATTGAACTTTCACTGGTAAAATCTACTAGTGAGTTCTCTACTGAAATACTGGGTACATTTTTCAACTAAAGTCATGGAAACATTTAGTTTCCCATGCATAAATTCAGCAAGCAGAATATTCTAGTGTTCCCCCTAGGGTAGATAGACATTGTGGTTTATTTTGCCATTAATATTTGTCAGAGGATTAGAAACTCCTTATTCAAAATATTTATCTTAATTCTATCACATGTAAAATGTTTAAAATTTATGTTCAAATTGTCTCATAAGAATGTTAAAAAATAAGACAAAGAACAGTCAAGGGTTTTGGACTTACTGAAAGGTAGATAACGATTCAAATTTAATTAATTAGTCATATTGGATAACTAAAATCTACCCAGAAAATGTGAGAAAATTACAGGCACTATACATTTCTCTTCTTCTGGTGAGTGAATCAGGTATCTCCTCACATAAGATATGAGATTATATTGTGTTATACTTATTTAATTTTGTGTGATATTTCATTCATAGAAAATAATGGCACTAATATAAAACATAATTAATTCAGAAAAGTTTGTAATCTCAGTCTTGAAGGCTATTGCTTTTTTATGCAATGATAAAAAATCAGTTATCTGTTGTATATATTGTTTAATTAAGTGAATGGTAATGTGTAATCTCATCTACAGCTAAGTCTAAAAATAATTCTTCTATAAGTAAAAAAAAATAGAGAATTATGGTTTCGACTAACATTAAGTATACCTTTTTTTGAATCAACAGGATGAAACCAAAGGAGATTATGAGAAAATCCTGGTGGCTCTTTGTGGAGGAAACTAAACATTCCCTTGATGGTCTCAAGCTATGATCAGAAGACTTTAATTATATATTTTCATCCTATAAGCTTAAATAGGAAAGTTTCTTCAACAGGATTACAGTGTAGCTACCTACATGCTGAAAAATATAGCCTTTAAATCATTTTTATATTATAACTCTGTATAATAGAGATAAGTCCATTTTTTAAAAATGTTTTCCCCAAACCATAAAACCCTATACAAGTTGTTCTAGTAACAATACATGAGAAAGATGTCTATGTAGCTGAAAATAAAATGACGTCACAAGACAATTGGTGTGTCATTGACTCTTCTATTTTGATTTTCTTTTCTGTGTAATTCAGTGGTTTAATTTGACATTAAGGGATACAAGCCTGAATTCTAGATTATAATTATTTAATGAAATAGAGTTCACATTCTGAATTGAAGAAAATACTTATAGCTTTTGAAAAGGGATACTACATTTTATCGTATGTGTACAGACTATTGAGATTGTGTCTCTGTATAATAAATTTATTGCACTAGCATTATAACAATTTGATATATTCTATATTTCATTAACTAGTATAAAGATGAAATGGCAATACTTGTAAAAAGTTCTCATGTTTGTTTCATGGTAATTTTAGGTTTACTTTTTCTAAGAAACTGCCAAATTGTTTTCCAGAGTGGTAATACTATTCCACTTTACCACCATAAATCTAACAGTGGTTCAGTTTCTCCACATCCTTGCCA