Transcript asmbl_133518

Sequence
Transcript Sequence for observation asmbl_133518 of TGE0056453:
CATAGCTGAGCCATGTACTTCAAACAGAAGGCAGCCAATTACTAACTTCTGGTTGCTAGGTGTGGCTTCCTTTAAAATCCTATAAAATCAGAAGCCCAAGTCTCCACTGCCAGTGTGAAATCTTCAGAGAAGAATTTCTCTTTAGTTCTTTGCAAGAAGGTAGAGATAAAGACACTTTTTCAAAAATGGCAATGGTATCAGAATTCCTCAAGCAGGCCTGGTTTATTGAAAATGAAGAGCAGGAATATGTTCAAACTGTGAAGTCATCCAAAGGTGGTCCCGGATCAGCGGTGAGCCCCTATCCTACCTTCAATCCATCCTCGGATGTCGCTGCCTTGCATAAGGCCATAATGGTTAAAGGTGTGGATGAAGCAACCATCATTGACATTCTAACTAAGCGAAACAATGCACAGCGTCAACAGATCAAAGCAGCATATCTCCAGGAAACAGGAAAGCCCCTGGATGAAACACTGAAGAAAGCCCTTACAGGTCACCTTGAGGAGGTTGTTTTAGCTCTGCTAAAAACTCCAGCGCAATTTGATGCTGATGAACTTCGTGCTGCCATGAAGGGCCTTGGAACTGATGAAGATACTCTAATTGAGATTTTGGCATCAAGAACTAACAAAGAAATCAGAGACATTAACAGGGTCTACAGAGAGGAACTGAAGAGAGATCTGGCCAAAGACATAACCTCAGACACATCTGGAGATTTTCGGAACGCTTTGCTTTCTCTTGCTAAGGGTGACCGATCTGAGGACTTTGGTGTGAATGAAGACTTGGCTGATTCAGATGCCAGGGTAAGGAAGTGCTTACAAAATACTGCTGCAGTTCATCTTCCTACCTTAAGTGGGGCTACCACATGATCCCCTGTGAAAGCAAATCTAAGATCTTCTGAGAGACCAATGGCTTCTTAATGTTCATTTCCTGAATGAGGCATGTCTTTCTGTAGCCCCCACACACAAAAAAGTAGTCTTTGTAAGTTTTCAATATCTCTCATTATTCGTAAAACCAGAGAGAACTGAAGAAGGACAATACAAATTTGATTTGTCATTCCCAAGAATTGTTTGTTAAAAAAAACTCTGACCTTTCGTTGTACTAGGTATAAGAAGGGGAAATGTAATTTTTTTATTATGTGCAATGGAAAGAGTAAGCATATTTAACGTTATTTTTAACAGAGAACTTTGGAATGGTTTATAGATGTCAATTTATATTGTCAAAATATTACTGCAATGATATAACAAGAGTATAGGATAAATTATAATAATATATGCTTTCTAACATATTGTTTTATTTAGTTTCAGTGACATTGCTGATTATTTATATGCCAAACCACTGGCAACATAAGAAAAATCATATCATTTTAAAGCCTGGAATTTCCATTTAAAACAAACAAACAACTAATATTTGCATTATGCCTTCTCATGGAACAGTATTCTCTAGAGAATTCATTACAGTGCTTCACTAAGGATAGAGATTTCTTTGTGCACCCCCATCCACTTCTGCTATACCAGTACATTATCATGTACATAATAGGCACTCATGAACTTTTTGTTCAACAAATGCATACATATCAGATCAATTTGCTTGAAAAATGCAAAATAATTTTTACATACATTGAAGGTTTTATCATTTTAATAGAAATTGTTCAAGCATATTAAGGAACAAGAGTTAGCATTTGAATAATTGCCCATAATAAAAAATTCTTATTTGCTTTTGACATTTCTGAATTTGCTTTCCATTTTAAGACTATCAGGGTTCTTAATATATATTTATGGAGGTTACATGGATTAGTGTGACCCAAGAGAATGATGGTAGTCAACATTTCAAAGTTAATAAAGACCGCTTGTGACAATAGGGCAGGGATTATATTTTTCATATATAAAAGAAAAAAATCTGTCATTTAGTAAGGTTGATCTATTTGTCTAAGATTATGCAGCTTTGAAATTGCAGAGTCAGAATTTGAATACAGAAATTCTAACATCAAAATGCAAGGTCCAGGTTACGGTTGAATTATTGATTTATAAGTAACATTTGCTGATAATTACTTTGAACAACACAGAGTAAAAAATCTTTAGAGATCCCCTTGGAGTTGTCTTACTATAGAGCATAATCTTAAAGCAATTTAGTTCAGCAAACATTTATTCTGCAAACATATATTCAGACTCTAGTGTTTACAAGGCACCTTGAGAGAAACTGTGGAAGATATTTGACAAACAAAATAAGGTCCCTATCTTTAAAGAACTTGCAATCTTATTGTTGACTACTCTGATTGTATTGGGCACAAAGCGATTGCCTATATAATCTTTGACAAGGTCTAACATTATTGTGCAGATATCATTTCAGCAGATAGTGAAGTGTTTACTTTTGTGTTTCTTGACAGGCCTTGTATGAAGCAGGAGAAA