Transcript asmbl_133516

Sequence
Transcript Sequence for observation asmbl_133516 of TGE0056971:
CATAGCTGAGCCATGTACTTCAAACAGAAGGCAGCCAATTACTAACTTCTGGTTGCTAGGTGTGGCTTCCTTTAAAATCCTATAAAATCAGAAGCCCAAGTCTCCACTGCCAGTGTGAAATCTTCAGAGAAGAATTTCTCTTTAGTTCTTTGCAAGAAGGTAGAGATAAAGACACTTTTTCAAAAATGGCAATGGTATCAGAATTCCTCAAGCAGGCCTGGTTTATTGAAAATGAAGAGCAGGAATATGTTCAAACTGTGAAGTCATCCAAAGGTGGTCCCGGATCAGCGGTGAGCCCCTATCCTACCTTCAATCCATCCTCGGATGTCGCTGCCTTGCATAAGGCCATAATGGTTAAAGGTGTGGATGAAGCAACCATCATTGACATTCTAACTAAGCGAAACAATGCACAGCGTCAACAGATCAAAGCAGCATATCTCCAGGAAACAGGAAAGCCCCTGGATGAAACACTGAAGAAAGCCCTTACAGGTCACCTTGAGGAGGTTGTTTTAGCTCTGCTAAAAACTCCAGCGCAATTTGATGCTGATGAACTTCGTGCTGCCATGAAGGGCCTTGGAACTGATGAAGATACTCTAATTGAGATTTTGGCATCAAGAACTAACAAAGAAATCAGAGACATTAACAGGGTCTACAGAGAGGAACTGAAGAGAGATCTGGCCAAAGACATAACCTCAGACACATCTGGAGATTTTCGGAACGCTTTGCTTTCTCTTGCTAAGGGTGACCGATCTGAGGACTTTGGTGTGAATGAAGACTTGGCTGATTCAGATGCCAGGGCCTTGTATGAAGCAGGAGAAAGGAGAAAGGGGACAGACGTAAACGTGTTCAATACCATCCTTACCACCAGAAGCTATCCACAACTTCGCAGAGTGTTTCAGAAATACACCAAGTACAGTAAGCATGACATGAACAAAGTTCTGGACCTGGAGTTGAAAGGTGACATTGAGAAATGCCTCACAGCTATCGGTATGTAGTCCAGCAGTTGAAAGAGTTTTCTAACTAGAAATTGTATTTTCAAAGCTATCCTATACTTAACAAGAACAACAGCAACAAAACCAATAAAAGAAAACAAAAAACAATCAGAAGTAGTGCATCTGTTTCAATTGAAGCAACGTAAAAGATTGGCAAAGTACTATAACCTTAATAACAATAGATATTATTCCCCTTTTCAAAAATAGAGAGAGATAGACTATACTTATTGAGCACCTACTTATATCAAACAATGTACCAGGCTGGGCACACCACAGAGGCAATTCAGAATGGTCACTGAGAGCATGGGATCTGGAATAAATGTAACATCTGGATAAATGTAACTTCAAGTCCTGGTCTACTGCTTGTTAATTGTACAATCTTGGGCAGGTCCAGGAGAGTCTGATTCAGTGGGTCCGAGTTGGCCTCTAAAAATCGGTACTTTTTAAAGATCTCCCAGGTTATTCAGACAACCATCAGGGTTGGGGAACCTATGTTCTCAAGCAGTGTTTCTCATTCATGACTATGCACTTGAATCCCCTGGAAAGCTTGTTAAAATGCAGATTCTGATTCCCCAGGTCTGGGGTGGAGCTTAGATTCTGCTTTTCTAACAAGCTCCCCATTGATGCCAATGCTGTTGGTCCATAGATCTCGACAAGATGAAGAACACTATGAACTGGAATGTGCTAGTATTATTTGGGTTCTGTTTTATATTTAAGCCCATCCTATCCCAGAGTTTTTTCTTCATTTATTCATTTATTTTTACTTATTTGTTTGTGCAACTCTTACTTTAGACACAGAGGTACATGTGCACGTTTGTTCCATGGGTGTTCTGCACTCAGGCAGTGAGCATAGTACCCAATAAGTAGTTTTTTGACCAATGCCCCTTCTCTCCCTGCCCTCTCTAGTAGTCTGCAGTGTCTGTTGTTCATAGGGTGTTCTTTTTAAATGTTCTTATAGTAACATAAATAAAGTATTTACATAGGCTTGAACACCTAGTGGCTTCTCCACTCCCAAGGAGAATATATGTTGGATAGCGCAAACTACTGAAGTTGCTCTTGAGATGTATTTAAGGTAATAAAAAAATTGATCGTCAGGGAAAAGAATATTCAAAACCACCATCTAGAGAGTCACAAATACCTTCTCAGAAGTTAACTGCCCTATATTGGGAGATGAGAGGTGAAGAATGATGATGAGGGATAGAACACTGTTGGCAAAATTCTATATTTCCTGTTTCTTTCATATGGATATTTCATTTTTTTCATGGTAAATACATCAACTAAAATTTTCTTCTCTAACAGTGAAGTGCGCCACAAGCAAACCAGCTTTCTTTGCAGAGAAGCTTCATCAAGCCATGAAAGGTGTTGGAACTCGCCATAAGGCATTGATCAGGATTATGGTTTCCCGTTCTGAAATTGACATGAATGATATCAAAGCATTCTATCAGAAGATGTATGGTATCTCCCTTTGCCAAGCCATCCTGGTATGTTTTGATTCCTCTAATGCCATCCCAACAAATGAAAGTTCTTTTTGCAAGATCTTCAAGGAGAAGAGTTGACTTATTGTATCTATAAATTTAATATGTAAGATTAATTTAATATATTATGGTGTATACTTCATGAGTAAATTGAACTTTCACTGGTAAAATCTACTAGTGAGTTCTCTACTGAAATACTGGGTACATTTTTCAACTAAAGTCATGGAAACATTTAGTTTCCCATGCATAAATTCAGCAAGCAGAATATTCTAGTGTTCCCCCTAGGGTAGATAGACATTGTGGTTTATTTTGCCATTAATATTTGTCAGAGGATTAGAAACTCCTTATTCAAAATATTTATCTTAATTCTATCACATGTAAAATGTTTAAAATTTATGTTCAAATTGTCTCATAAGAATGTTAAAAAATAAGACAAAGAACAGTCAAGGGTTTTGGACTTACTGAAAGGTAGATAACGATTCAAATTTAATTAATTAGTCATATTGGATAACTAAAATCTACCCAGAAAATGTGAGAAAATTACAGGCACTATACATTTCTCTTCTTCTGGTGAGTGAATCAGGTATCTCCTCACATAAGATATGAGATTATATTGTGTTATACTTATTTAATTTTGTGTGATATTTCATTCATAGAAAATAATGGCACTAATATAAAACATAATTAATTCAGAAAAGTTTGTAATCTCAGTCTTGAAGGCTATTGCTTTTTTATGCAATGATAAAAAATCAGTTATCTGTTGTATATATTGTTTAATTAAGTGAATGGTAATGTGTAATCTCATCTACAGCTAAGTCTAAAAATAATTCTTCTATAAGTAAAAAAAAATAGAGAATTATGGTTTCGACTAACATTAAGTATACCTTTTTTTGAATCAACAGGATGAAACCAAAGGAGATTATGAGAAAATCCTGGTGGCTCTTTGTGGAGGAAACTAAACATTCCCTTGATGGTCTCAAGCTATGATCAGAAGACTTTAATTATATATTTTCATCCTATAAGCTTAAATAGGAAAGTTTCTTCAACAGGATTACAGTGTAGCTACCTACATGCTGAAAAATATAGCCTTTAAATCATTTTTATATTATAACTCTGTATAATAGAGATAAGTCCATTTTTTAAAAATGTTTTCCCCAAACCATAAAACCCTATACAAGTTGTTCTAGTAACAATACATGAGAAAGATGTCTATGTAGCTGAAAATAAAATGACGTCACAAGACAATTGGTGTGTCATTGACTCTTCTATTTTGATTTTCTTTTCTGTGTAATTCAGTGGTTTAATTTGACATTAAGGGATACAAGCCTGAATTCTAGATTATAATTATTTAATGAAATAGAGTTCACATTCTGAATTGAAGAAAATACTTATAGCTTTTGAAAAGGGATACTACATTTTATCGTATGTGTACAGACTATTGAGATTGTGTCTCTGTATAATAAATTTATTGCACTAGCATTATAACAATTTGATATATTCTATATTTCATTAACTAGTATAAAGATGAAATGGCAATACTTGTAAAAAGTTCTCATGTTTGTTTCATGGTAATTTTAGGTTTACTTTTTCTAAGAAACTGCCAAATTGTTTTCCAGAGTGGTAATACTATTCCACTTTACCACCATAAATCTAACAGTGGTTCAGTTTCTCCACATCCTTGCCA