Transcript asmbl_133515

Sequence
Transcript Sequence for observation asmbl_133515 of TGE0056971:
CATAGCTGAGCCATGTACTTCAAACAGAAGGCAGCCAATTACTAACTTCTGGTTGCTAGGTGTGGCTTCCTTTAAAATCCTATAAAATCAGAAGCCCAAGTCTCCACTGCCAGTGTGAAATCTTCAGAGAAGAATTTCTCTTTAGTTCTTTGCAAGAAGGTAGAGATAAAGACACTTTTTCAAAAATGGCAATGGTATCAGAATTCCTCAAGCAGGCCTGGTTTATTGAAAATGAAGAGCAGGAATATGTTCAAACTGTGAAGTCATCCAAAGGTGGTCCCGGATCAGCGGTGAGCCCCTATCCTACCTTCAATCCATCCTCGGATGTCGCTGCCTTGCATAAGGCCATAATGGTTAAAGGTGTGGATGAAGCAACCATCATTGACATTCTAACTAAGCGAAACAATGCACAGCGTCAACAGATCAAAGCAGCATATCTCCAGGAAACAGGAAAGCCCCTGGATGAAACACTGAAGAAAGCCCTTACAGGTCACCTTGAGGAGGTTGTTTTAGCTCTGCTAAAAACTCCAGCGCAATTTGATGCTGATGAACTTCGTGCTGCCATGAAGGGCCTTGGAACTGATGAAGATACTCTAATTGAGATTTTGGCATCAAGAACTAACAAAGAAATCAGAGACATTAACAGGGTCTACAGAGAGGAACTGAAGAGAGATCTGGCCAAAGACATAACCTCAGACACATCTGGAGATTTTCGGAACGCTTTGCTTTCTCTTGCTAAGGGTGACCGATCTGAGGACTTTGGTGTGAATGAAGACTTGGCTGATTCAGATGCCAGGGCCTTGTATGAAGCAGGAGAAAGGAGAAAGGGGACAGACGTAAACGTGTTCAATACCATCCTTACCACCAGAAGCTATCCACAACTTCGCAGAGTGTTTCAGAAATACACCAAGTACAGTAAGCATGACATGAACAAAGTTCTGGACCTGGAGTTGAAAGGTGACATTGAGAAATGCCTCACAGCTATCGGTATGTAGTCCAGCAGTTGAAAGAGTTTTCTAACTAGAAATTGTATTTTCAAAGCTATCCTATACTTAACAAGAACAACAGCAACAAAACCAATAAAAGAAAACAAAAAACAATCAGAAGTAGTGCATCTGTTTCAATTGAAGCAACGTAAAAGATTGGCAAAGTACTATAACCTTAATAACAATAGATATTATTCCCCTTTTCAAAAATAGAGAGAGATAGACTATACTTATTGAGCACCTACTTATATCAAACAATGTACCAGGCTGGGCACACCACAGAGGCAATTCAGAATGGTCACTGAGAGCATGGGATCTGGAATAAATGTAACATCTGGATAAATGTAACTTCAAGTCCTGGTCTACTGCTTGTTAATTGTACAATCTTGGGCAGGTCCAGGAGAGTCTGATTCAGTGGGTCCGAGTTGGCCTCTAAAAATCGGTACTTTTTAAAGATCTCCCAGGTTATTCAGACAACCATCAGGGTTGGGGAACCTATGTTCTCAAGCAGTGTTTCTCATTCATGACTATGCACTTGAATCCCCTGGAAAGCTTGTTAAAATGCAGATTCTGATTCCCCAGGTCTGGGGTGGAGCTTAGATTCTGCTTTTCTAACAAGCTCCCCATTGATGCCAATGCTGTTGGTCCATAGATCTCGACAAGATGAAGAACACTATGAACTGGAATGTGCTAGTATTATTTGGGTTCTGTTTTATATTTAAGCCCATCCTATCCCAGAGTTTTTTCTTCATTTATTCATTTATTTTTACTTATTTGTTTGTGCAACTCTTACTTTAGACACAGAGGTACATGTGCACGTTTGTTCCATGGGTGTTCTGCACTCAGGCAGTGAGCATAGTACCCAATAAGTAGTTTTTTGACCAATGCCCCTTCTCTCCCTGCCCTCTCTAGTAGTCTGCAGTGTCTGTTGTTCATAGGGTGTTCTTTTTAAATGTTCTTATAGTAACATAAATAAAGTATTTACATAGGCTTGAACACCTAGTGGCTTCTCCACTCCCAAGGAGAATATATGTTGGATAGCGCAAACTACTGAAGTTGCTCTTGAGATGTATTTAAGGTAATAAAAAAATTGATCGTCAGGGAAAAGAATATTCAAAACCACCATCTAGAGAGTCACAAATACCTTCTCAGAAGTTAACTGCCCTATATTGGGAGATGAGAGGTGAAGAATGATGATGAGGGATAGAACACTGTTGGCAAAATTCTATATTTCCTGTTTCTTTCATATGGATATTTCATTTTTTTCATGGTAAATACATCAACTAAAATTTTCTTCTCTAACAGTGAAGTGCGCCACAAGCAAACCAGCTTTCTTTGCAGAGAAGCTTCATCAAGCCATGAAAGTATGTACCATTCTACTTATATGTCCTGCTTAGAGGAAGAATTATTTGTAGAAAGAACAGAAAACCTCATGTTGTTTGAAAATCTCACATTTAATATCTTCCCATTAATGAGAATCATTGTTCTATTTGATGAAAGAGGTAATACACTACCTTCTCAGAATAAACTTCTGTTAGATTCGGTGCTTTTTTTTACAGATGAGATTGTAAAGTGAGCCTGTAAGTGATTTACGGCTCACTTGTGATTTGCTTAAAACATGTGTCACCACGGGAAGGGTGATGTACTTTCTTTTTTAACGTGTAATTTTAGTGGCCTACTTCCTCTAAGGTTGTGAGTTTTATAATCTCCCACTTTATGAGTCTGATTTGTTGTTTTTATTATTCTGTCTTTTATGCCACAGATTAATAGTTGAAACTTTTGAAATGTCATTCTATGATTAAGGATGTAGAATGATGTATTTGAGATCAACTATGTCACTTTAACTTTACTGTCTGACATGCATGGTATTATACAAGGTACCTCTTCTATTCTGACATTTTGAGCCCACAAATGAATAGTTATGAAGTTATCTTCCTTTTTTCTTTGCAGCTCCAAAATAAGGAGGTTTTCAGAGAGAGAGAGAAAGAAAGATCTAACTATTTGAATAATATGAAGGAATATTTTGAATATATATGAATAATTTGAATAATATGAAATGATAGACATGCTAGGTACTGCTCTGTAGTGGTTAGCATAGTTGCTGCCCCCTTTCTGCCATAGTCTAGTGTGATATTTCGTTGGGTAATGATGAATACCTGGTGCCATGGAAGAGAAAAGTGGGACATATACTCCAGACTTTGGAAATCCAGGTAGCATTGCTGTCAGCTAAATTAACACCTGAAGTTTAAATAGAAATGAGCCAGATGAGGGCAAGAGTGGAAGAGATGGGGATAAAGCAAGGGTGGTCCAAGAGGAAGAAGTAACCCACACACAGGCTTGAAGGCAAAAGGTAACATAACCTTCTCAAGACAGTAAGTATAGAGTGATGGTGCACACTGGAAGAGATGGTAGAATTAGGCAGGATATTGTAAGCCTTGAAAAAGAATTAGGCAGGATATCGGAAGCCCTGATTAGATTCTATCCTAAGAGCAACAGAAGATCACTGACAGTGTTTTAAATAGATAGACTAGTTTATTAGATTTGCAGTTTAGAAGTTCCCTTTTTTTGTAATTATTGGACAGTGTAGAGACCGGATGGTGAGAGATGAGTTAGGAAGTTGTGACAGCTCTCTATACCTACCGCTAATGTAGAGGATTATTTATTTTCATTTCATTACCATTCGTGTAAGGTGTGTGTGTGTGTGTGTGTG