Transcript asmbl_133514

Sequence
Transcript Sequence for observation asmbl_133514 of TGE0056972:
CATAGCTGAGCCATGTACTTCAAACAGAAGGCAGCCAATTACTAACTTCTGGTTGCTAGGTGTGGCTTCCTTTAAAATCCTATAAAATCAGAAGCCCAAGTCTCCACTGCCAGTGTGAAATCTTCAGAGAAGAATTTCTCTTTAGTTCTTTGCAAGAAGGTAGAGATAAAGACACTTTTTCAAAAATGGCAATGGTATCAGAATTCCTCAAGCAGGCCTGGTTTATTGAAAATGAAGAGCAGGAATATGTTCAAACTGTGAAGTCATCCAAAGGTGGTCCCGGATCAGCGGTGAGCCCCTATCCTACCTTCAATCCATCCTCGGATGTCGCTGCCTTGCATAAGGCCATAATGGTTAAAGGTGTGGATGAAGCAACCATCATTGACATTCTAACTAAGCGAAACAATGCACAGCGTCAACAGATCAAAGCAGCATATCTCCAGGAAACAGGAAAGCCCCTGGATGAAACACTGAAGAAAGCCCTTACAGGTCACCTTGAGGAGGTTGTTTTAGCTCTGCTAAAAACTCCAGCGCAATTTGATGCTGATGAACTTCGTGCTGCCATGAAGGGCCTTGGAACTGATGAAGATACTCTAATTGAGATTTTGGCATCAAGAACTAACAAAGAAATCAGAGACATTAACAGGGTCTACAGAGAGGAACTGAAGAGAGATCTGGCCAAAGACATAACCTCAGACACATCTGGAGATTTTCGGAACGCTTTGCTTTCTCTTGCTAAGGTACAACTCAGATACTTTAGGAAATGCCTCTTGTTTTATAAAGACTAATTTCTTAGTCCATTTTGTGTTGCTATAAGGGAATATCTGAGGCTAGGTAATTTTTAAAGATAAAAAGGTTTATTTGGCTCAGGATTCTGATGGCTAACAAATTCAAGTTTGGGTATCTATGTCTGGTGAGAGCCTCAGGCTGCTTCCACTCCTGACAGAAGAGGAAAGGGAGCTGGTGTGTGCAGAGACCACATGGCAAGAAAGGAAGCAAGAGAGAGAATGGGGAGGTGCCAGCCTCGTTAACAACCAGCTCTCGTGGTTCTCATGAGCAAGAACTCATTCCCAGTGACGGCATTAATCTCTTCATGAGAGATCAGCCCCAGGACCCAAATACCTCCCTCTAGGCCCCACCTTTAACACTGGGGATCAAATTTCAACATGAGGTTTGGAGGGGAAGAACATCTAAAACCATCGCAAGTAAAATCTTGTATCTGAGCTCCTTCTAGAAATGAGTAATAGAATACCTTTTTCTCAAAAAATATTATTTATCTGAGTTTAAGATAATTAAGTAAATCATGCAATTACATGCTAGAGAAGAGCTTACAATAGAATGGGATTTCTTTCAGG