Transcript asmbl_133513

Sequence
Transcript Sequence for observation asmbl_133513 of TGE0056971:
ATAAAACTCCTTAGAAAAGCACAAAGCAAAACTAAAGAAGAGTATTTACTAGTGTTGGATATATTTGTAAAAGTGAGATTACAAATCATGTATCTGGCTATTTTTTTCTTAAACATGTTCCTTCAAGAATTTTTCTGTTCGTTCATTTTAAATATTTATTAAATGTTCTGATTTCTTATGTTCACTGCTAGCTAATTAACAAGGATGGAATTTTTCTTGCCTTGGTTATATCTAAAAGATTGTAAAAACTTTGAGAAAGCAATGTTGCCCTCTTTCCACAGGAGTATTTTGGTAGCTGTAAGAGAATGCACATTGCAAATGACTCAAATGTGGTAAAATGTTGGTTTCATAATTCTGAAATGGCCTCTTCCCCAAAAGTGACAGTAACACCCTAGCTCCAGGCTCAACCACATCCAGCACATAGCCAACATTTAACAGATGTTGACAAAATAGTTAATAATAATATTATTAAGGAACCAGCCAGAGTTTCATGCTTATTAAATACTTTTTCAACCAGAAGGTCTGCAAAGGTTGATTTCTGAATATGACGTTAGCTCTCTCTAGACCTATTAATTTACGACATTTCAAATCAGAGGTAAACCAGCAGACCTATTATTTTTCAATGATAAACTATAAACAGTTTTTTGAAGTCAACTATTTCCTTTTCCTTTAAAATTGGACAGAATTTCATCAGGAAGCTCAGAACAATCCAATTTATATAATGCCTTCCTTCATTATGCTAATTTTCTTCATCTTCATCTACTTGAAGTAATATTTAAGATTGGCACTTCAGAGCTGTAAATGGATCTTAGATGATAATTACTTCAACATTCTTATTTTATAAACGAAGACCCTCTGGAGAAGCTAAATGTTTTTCTTGAGGTCAGATCGCCAGATAATCAAGAACCAGTATACTTCAATTTGTATTTTATATCCTATAGTTGTGGGTAGAAAATGTTCATTAAATTAGTGTAGATATGTTTTTTAAAATATTAGCAATGATACATGATATTCATTCAATAATACTTATTAACATCCTAAATTCCAGGCATTTTGCTAGGGATTGGAAGTACATACATAATGAATATTATTATTTGTATGTTAGCACGGGCCTCATGGCCTGCTCCTGGGGAATATAAACAAGCCAATGGAAAGTGATAATACAGAAAGGTGGGGCTGGTGTAGGGGTGAAGTCAGGATGCTTTGGGAGAGCATGGAAGGTCACCGAATCCAGTGCTGAGGAACTAATGAAGGGTTTCTGAAGAACGTGATGAGATCAATGCTGATGAGTCACTTAGAAGTAGCAATTAGTTAGGCAAAGGGAAGTGAATGTGGAGGAGGAACAAGCATTCCAGGCAAGAAGAACACCCTATCGAAAAGCCTGGAAGCAAAACATTAGTGAGGCTACCTTTCATAAATTGCTTTCTGTAAGTCATGCCATTGTGTAGTCTTAATTGCTTTCTCTCACCAGGGAAGGTGTGGGAAGGACTTGTGAAATACATATTCGAGGAAAAACTATGCACAAGGCCGTGCATTTAAAAATAAACTCCCTAAGGCTGGGGTGAAACCTGCTACGGTCTGCGCAAGTTGACTGTTAATGAATTTGATTCTCAGACACTTTTTCAAAAATGGCAATGGTATCAGAATTCCTCAAGCAGGCCTGGTTTATTGAAAATGAAGAGCAGGAATATGTTCAAACTGTGAAGTCATCCAAAGGTGGTCCCGGATCAGCGGTGAGCCCCTATCCTACCTTCAATCCATCCTCGGATGTCGCTGCCTTGCATAAGGCCATAATGGTTAAAGGTGTGGATGAAGCAACCATCATTGACATTCTAACTAAGCGAAACAATGCACAGCGTCAACAGATCAAAGCAGCATATCTCCAGGAAACAGGAAAGCCCCTGGATGAAACACTGAAGAAAGCCCTTACAGGTCACCTTGAGGAGGTTGTTTTAGCTCTGCTAAAAACTCCAGCGCAATTTGATGCTGATGAACTTCGTGCTGCCATGAAGGGCCTTGGAACTGATGAAGATACTCTAATTGAGATTTTGGCATCAAGAACTAACAAAGAAATCAGAGACATTAACAGGGTCTACAGAGAGGAACTGAAGAGAGATCTGGCCAAAGACATAACCTCAGACACATCTGGAGATTTTCGGAACGCTTTGCTTTCTCTTGCTAAGGGTGACCGATCTGAGGACTTTGGTGTGAATGAAGACTTGGCTGATTCAGATGCCAGGGCCTTGTATGAAGCAGGAGAAAGGAGAAAGGGGACAGACGTAAACGTGTTCAATACCATCCTTACCACCAGAAGCTATCCACAACTTCGCAGAGTGTTTCAGAAATACACCAAGTACAGTAAGCATGACATGAACAAAGTTCTGGACCTGGAGTTGAAAGGTGACATTGAGAAATGCCTCACAGCTATCGGTATGTAGTCCAGCAGTTGAAAGAGTTTTCTAACTAGAAATTGTATTTTCAAAGCTATCCTATACTTAACAAGAACAACAGCAACAAAACCAATAAAAGAAAACAAAAAACAATCAGAAGTAGTGCATCTGTTTCAATTGAAGCAACGTAAAAGATTGGCAAAGTACTATAACCTTAATAACAATAGATATTATTCCCCTTTTCAAAAATAGAGAGAGATAGACTATACTTATTGAGCACCTACTTATATCAAACAATGTACCAGGCTGGGCACACCACAGAGGCAATTCAGAATGGTCACTGAGAGCATGGGATCTGGAATAAATGTAACATCTGGATAAATGTAACTTCAAGTCCTGGTCTACTGCTTGTTAATTGTACAATCTTGGGCAGGTCCAGGAGAGTCTGATTCAGTGGGTCCGAGTTGGCCTCTAAAAATCGGTACTTTTTAAAGATCTCCCAGGTTATTCAGACAACCATCAGGGTTGGGGAACCTATGTTCTCAAGCAGTGTTTCTCATTCATGACTATGCACTTGAATCCCCTGGAAAGCTTGTTAAAATGCAGATTCTGATTCCCCAGGTCTGGGGTGGAGCTTAGATTCTGCTTTTCTAACAAGCTCCCCATTGATGCCAATGCTGTTGGTCCATAGATCTCGACAAGATGAAGAACACTATGAACTGGAATGTGCTAGTATTATTTGGGTTCTGTTTTATATTTAAGCCCATCCTATCCCAGAGTTTTTTCTTCATTTATTCATTTATTTTTACTTATTTGTTTGTGCAACTCTTACTTTAGACACAGAGGTACATGTGCACGTTTGTTCCATGGGTGTTCTGCACTCAGGCAGTGAGCATAGTACCCAATAAGTAGTTTTTTGACCAATGCCCCTTCTCTCCCTGCCCTCTCTAGTAGTCTGCAGTGTCTGTTGTTCATAGGGTGTTCTTTTTAAATGTTCTTATAGTAACATAAATAAAGTATTTACATAGGCTTGAACACCTAGTGGCTTCTCCACTCCCAAGGAGAATATATGTTGGATAGCGCAAACTACTGAAGTTGCTCTTGAGATGTATTTAAGGTAATAAAAAAATTGATCGTCAGGGAAAAGAATATTCAAAACCACCATCTAGAGAGTCACAAATACCTTCTCAGAAGTTAACTGCCCTATATTGGGAGATGAGAGGTGAAGAATGATGATGAGGGATAGAACACTGTTGGCAAAATTCTATATTTCCTGTTTCTTTCATATGGATATTTCATTTTTTTCATGGTAAATACATCAACTAAAATTTTCTTCTCTAACAGTGAAGTGCGCCACAAGCAAACCAGCTTTCTTTGCAGAGAAGCTTCATCAAGCCATGAAAGTATGTACCATTCTACTTATATGTCCTGCTTAGAGGAAGAATTATTTGTAGAAAGAACAGAAAACCTCATGTTGTTTGAAAATCTCACATTTAATATCTTCCCATTAATGAGAATCATTGTTCTATTTGATGAAAGAGGTAATACACTACCTTCTCAGAATAAACTTCTGTTAGATTCGGTGCTTTTTTTTACAGATGAGATTGTAAAGTGAGCCTGTAAGTGATTTACGGCTCACTTGTGATTTGCTTAAAACATGTGTCACCACGGGAAGGGTGATGTACTTTCTTTTTTAACGTGTAATTTTAGTGGCCTACTTCCTCTAAGGTTGTGAGTTTTATAATCTCCCACTTTATGAGTCTGATTTGTTGTTTTTATTATTCTGTCTTTTATGCCACAGATTAATAGTTGAAACTTTTGAAATGTCATTCTATGATTAAGGATGTAGAATGATGTATTTGAGATCAACTATGTCACTTTAACTTTACTGTCTGACATGCATGGTATTATACAAGGTACCTCTTCTATTCTGACATTTTGAGCCCACAAATGAATAGTTATGAAGTTATCTTCCTTTTTTCTTTGCAGCTCCAAAATAAGGAGGTTTTCAGAGAGAGAGAGAAAGAAAGATCTAACTATTTGAATAATATGAAGGAATATTTTGAATATATATGAATAATTTGAATAATATGAAATGATAGACATGCTAGGTACTGCTCTGTAGTGGTTAGCATAGTTGCTGCCCCCTTTCTGCCATAGTCTAGTGTGATATTTCGTTGGGTAATGATGAATACCTGGTGCCATGGAAGAGAAAAGTGGGACATATACTCCAGACTTTGGAAATCCAGGTAGCATTGCTGTCAGCTAAATTAACACCTGAAGTTTAAATAGAAATGAGCCAGATGAGGGCAAGAGTGGAAGAGATGGGGATAAAGCAAGGGTGGTCCAAGAGGAAGAAGTAACCCACACACAGGCTTGAAGGCAAAAGGTAACATAACCTTCTCAAGACAGTAAGTATAGAGTGATGGTGCACACTGGAAGAGATGGTAGAATTAGGCAGGATATTGTAAGCCTTGAAAAAGAATTAGGCAGGATATCGGAAGCCCTGATTAGATTCTATCCTAAGAGCAACAGAAGATCACTGACAGTGTTTTAAATAGATAGACTAGTTTATTAGATTTGCAGTTTAGAAGTTCCCTTTTTTTGTAATTATTGGACAGTGTAGAGACCGGATGGTGAGAGATGAGTTAGGAAGTTGTGACAGCTCTCTATACCTACCGCTAATGTAGAGGATTATTTATTTTCATTTCATTACCATTCGTGTAAGGTGTGTGTGTGTGTGTGTGTG