Transcript asmbl_133512

Sequence
Transcript Sequence for observation asmbl_133512 of TGE0056970:
AAACAGTTCCCTCCTGGACATTTCAGAATGGCTATTTGAATGACTGTCAAAAAACAGACATGTGCAATGGAAAGAATCTGTTTCATTTTGAAGATAAAAACATTTCTTTGCCAAACGAAGATGTAATTATTTACTTAACACTGAGGAAATTGTGTTCACATCAGTGGAATCTCTATTGTTACAGCAGATATTACTGGCTCATTTCTAGCAGAAATTCCATGCTGAAATTAAAAGCTCTGTTCACATATAGAGTTGCAACTAGTATCAAACACTGCAACACTGAGGGCCAGGAAAAGTTAATTGTCTCTTCCTTTCTCACTCGAATGAAATGTCATTCTCCCAAGTGCTTCCTTGATATGTAGTATAGCATCGATTTTTTAGGCTGATATATAATTTATATTTCTTAATTTGTTAAGAAGTTCTTTTGGAGCATCTCAGTAATGAATTATTTTATGTCAATTGATGATGAAGAAAATTGGTGTTAAAGGCTGTTGGCCCTTTATTTCCAGGTGTGGATGAAGCAACCATCATTGACATTCTAACTAAGCGAAACAATGCACAGCGTCAACAGATCAAAGCAGCATATCTCCAGGAAACAGGAAAGCCCCTGGATGAAACACTGAAGAAAGCCCTTACAGGTCACCTTGAGGAGGTTGTTTTAGCTCTGCTAAAAACTCCAGCGCAATTTGATGCTGATGAACTTCGTGCTGCCATGAAGGGCCTTGGAACTGATGAAGATACTCTAATTGAGATTTTGGCATCAAGAACTAACAAAGAAATCAGAGACATTAACAGGGTCTACAGAGAGGAACTGAAGAGAGATCTGGCCAAAGACATAACCTCAGACACATCTGGAGATTTTCGGAACGCTTTGCTTTCTCTTGCTAAGGGTGACCGATCTGAGGACTTTGGTGTGAATGAAGACTTGGCTGATTCAGATGCCAGGGCCTTGTATGAAGCAGGAGAAAGGAGAAAGGGGACAGACGTAAACGTGTTCAATACCATCCTTACCACCAGAAGCTATCCACAACTTCGCAGAGTGTTTCAGAAATACACCAAGTACAGTAAGCATGACATGAACAAAGTTCTGGACCTGGAGTTGAAAGGTGACATTGAGAAATGCCTCACAGCTATCGGTATGTAGTCCAGCAGTTGAAAGAGTTTTCTAACTAGAAATTGTATTTTCAAAGCTATCCTATACTTAACAAGAACAACAGCAACAAAACCAATAAAAGAAAACAAAAAACAATCAGAAGTAGTGCATCTGTTTCAATTGAAGCAACGTAAAAGATTGGCAAAGTACTATAACCTTAATAACAATAGATATTATTCCCCTTTTCAAAAATAGAGAGAGATAGACTATACTTATTGAGCACCTACTTATATCAAACAATGTACCAGGCTGGGCACACCACAGAGGCAATTCAGAATGGTCACTGAGAGCATGGGATCTGGAATAAATGTAACATCTGGATAAATGTAACTTCAAGTCCTGGTCTACTGCTTGTTAATTGTACAATCTTGGGCAGGTCCAGGAGAGTCTGATTCAGTGGGTCCGAGTTGGCCTCTAAAAATCGGTACTTTTTAAAGATCTCCCAGGTTATTCAGACAACCATCAGGGTTGGGGAACCTATGTTCTCAAGCAGTGTTTCTCATTCATGACTATGCACTTGAATCCCCTGGAAAGCTTGTTAAAATGCAGATTCTGATTCCCCAGGTCTGGGGTGGAGCTTAGATTCTGCTTTTCTAACAAGCTCCCCATTGATGCCAATGCTGTTGGTCCATAGATCTCGACAAGATGAAGAACACTATGAACTGGAATGTGCTAGTATTATTTGGGTTCTGTTTTATATTTAAGCCCATCCTATCCCAGAGTTTTTTCTTCATTTATTCATTTATTTTTACTTATTTGTTTGTGCAACTCTTACTTTAGACACAGAGGTACATGTGCACGTTTGTTCCATGGGTGTTCTGCACTCAGGCAGTGAGCATAGTACCCAATAAGTAGTTTTTTGACCAATGCCCCTTCTCTCCCTGCCCTCTCTAGTAGTCTGCAGTGTCTGTTGTTCATAGGGTGTTCTTTTTAAATGTTCTTATAGTAACATAAATAAAGTATTTACATAGGCTTGAACACCTAGTGGCTTCTCCACTCCCAAGGAGAATATATGTTGGATAGCGCAAACTACTGAAGTTGCTCTTGAGATGTATTTAAGGTAATAAAAAAATTGATCGTCAGGGAAAAGAATATTCAAAACCACCATCTAGAGAGTCACAAATACCTTCTCAGAAGTTAACTGCCCTATATTGGGAGATGAGAGGTGAAGAATGATGATGAGGGATAGAACACTGTTGGCAAAATTCTATATTTCCTGTTTCTTTCATATGGATATTTCATTTTTTTCATGGTAAATACATCAACTAAAATTTTCTTCTCTAACAGTGAAGTGCGCCACAAGCAAACCAGCTTTCTTTGCAGAGAAGCTTCATCAAGCCATGAAAGTATGTACCATTCTACTTATATGTCCTGCTTAGAGGAAGAATTATTTGTAGAAAGAACAGAAAACCTCATGTTGTTTGAAAATCTCACATTTAATATCTTCCCATTAATGAGAATCATTGTTCTATTTGATGAAAGAGGTAATACACTACCTTCTCAGAATAAACTTCTGTTAGATTCGGTGCTTTTTTTTACAGATGAGATTGTAAAGTGAGCCTGTAAGTGATTTACGGCTCACTTGTGATTTGCTTAAAACATGTGTCACCACGGGAAGGGTGATGTACTTTCTTTTTTAACGTGTAATTTTAGTGGCCTACTTCCTCTAAGGTTGTGAGTTTTATAATCTCCCACTTTATGAGTCTGATTTGTTGTTTTTATTATTCTGTCTTTTATGCCACAGATTAATAGTTGAAACTTTTGAAATGTCATTCTATGATTAAGGATGTAGAATGATGTATTTGAGATCAACTATGTCACTTTAACTTTACTGTCTGACATGCATGGTATTATACAAGGTACCTCTTCTATTCTGACATTTTGAGCCCACAAATGAATAGTTATGAAGTTATCTTCCTTTTTTCTTTGCAGCTCCAAAATAAGGAGGTTTTCAGAGAGAGAGAGAAAGAAAGATCTAACTATTTGAATAATATGAAGGAATATTTTGAATATATATGAATAATTTGAATAATATGAAATGATAGACATGCTAGGTACTGCTCTGTAGTGGTTAGCATAGTTGCTGCCCCCTTTCTGCCATAGTCTAGTGTGATATTTCGTTGGGTAATGATGAATACCTGGTGCCATGGAAGAGAAAAGTGGGACATATACTCCAGACTTTGGAAATCCAGGTAGCATTGCTGTCAGCTAAATTAACACCTGAAGTTTAAATAGAAATGAGCCAGATGAGGGCAAGAGTGGAAGAGATGGGGATAAAGCAAGGGTGGTCCAAGAGGAAGAAGTAACCCACACACAGGCTTGAAGGCAAAAGGTAACATAACCTTCTCAAGACAGTAAGTATAGAGTGATGGTGCACACTGGAAGAGATGGTAGAATTAGGCAGGATATTGTAAGCCTTGAAAAAGAATTAGGCAGGATATCGGAAGCCCTGATTAGATTCTATCCTAAGAGCAACAGAAGATCACTGACAGTGTTTTAAATAGATAGACTAGTTTATTAGATTTGCAGTTTAGAAGTTCCCTTTTTTTGTAATTATTGGACAGTGTAGAGACCGGATGGTGAGAGATGAGTTAGGAAGTTGTGACAGCTCTCTATACCTACCGCTAATGTAGAGGATTATTTATTTTCATTTCATTACCATTCGTGTAAGGTGTGTGTGTGTGTGTGTGTG