Transcript asmbl_133030

Sequence
Transcript Sequence for observation asmbl_133030 of TGE0056969:
GGTTGGAATTGCTTTTATTGGGGGCGGATACCGCAAGGCCCCGCCCACGGTCAGGTTAGTGTTCTGCCCTTGCAGAGGCGCCAGCAGCCTGACACCTCCACCTGCCACCCGCCCGGGGTTAGTGGAACATGCAAAGCTCAGAGGGTGGAGGCAGGGGTGGTCGCTGCTGAGACCAGGGCTGGGTGCAACAGGAGGGTCAGCACAGAGCCTGGCTGGTGTCCCTGGGCCCAAAGGGGGCTGGGGCTCCATGGGAGAGAGACGGGCAGGCGGCACCCCAGTGTGGGGCTCCACAAGCTGGAGGGGCCCCTGGACCCACCAGGAGGACAGGTCTGCAGTTCCCAGCCATGCCGGCTGGAACGTCCGCCTCCCCACTGGGTCTGGGTCCTCGGGGCCTGGGGTTAGAGGCCGACATGGAAGGCACTTACTAGGGGAACAGAGGCTGGAGGCTGACGCCGGAGGCCAGGGGTCTCAGGAGTGAGTGTGGGGGGTGAGCTGGAAAGCACAGATCAGACAGCACTGTGGGGGCTGGGCCCGAGGGCCTCGTCTTCCCATGGGGAAGGGGCTTCTCTGGGTAGACTGGGAGAGAGGCTGACTGGGGCCCCCCGTCCCCAGCAAGGCCCACCGTGCAGGCCAGTGCTAGAAACACCAGGGCCCTCTACAGACAGGGTTGGGCCCAGCTGCCCTGTGCAGCTAGGACTGGCAGGCGGGCTACCCTGGGAAGACAGGAGGGTGGGCTGGGGCCCAGCTTGGGACCCTCCAAGGCACCTGGCTGTGTGAGTGGCAGGTAGAAGGGAGTGAGGAGACCCGAGGGGGTGAGGCGGCCAGCAGGGCTGGGCCAGCCCTGTCCCCCAAGATACAGGCTGTCTGGACAGCAGATATATATTAATATATTAGTCTGGTCTTTTTGGTTAAACTTTAGGCACCACTTGGGAGGAAGACACCTTTAAGCGTTGAAAACGGCCCCCGCGCCTCGGTGGGAGCCGGGCTGGGCCGCATGCAGAGCGGGGTGGGCGCAGGCAGCCTCAGGCCACGGCAGACTCAGGGCCCCCCAGGGAGGCCGAGGACCCCGAGGCGTAGCGGCGGCCGTAGCCCGAGGAGGAGTAGGAGGATGAAGAGAAGGTCATGGAGAAGCCGGAGCCGGTGGCGTCAAAGCTGCCGCGGCGGGAGCCGGCCCGGGAGCCGGTGCGCGAGCCGGTGCGGGAGCCAGCGGTAGAGCCGGAGCCGCTGACGCTGTAGGGGCTGTAGTAGCCCTTGGTGGACTGCGCGGCAGCCTCCAGCAGCCGCAGCCCCGTGCCCTCCTCCACCATGCTGCGGTCCAGCGCGTCCTTATAGGAGATCTTGAGCTTGGTCTTAGGGCAGGTGAGGTACTTGGAGTAGGCGCCCACGTCACGCAGCTTCTGTGCGGTGCGGGCGTCCACCGTGCCGCGCTGCAGGGCCTCGTCCAGGGGCACGCGGCCCGGCGTGTCGGGCTCGATCAAGCCGCCGGTCAGGTACTGCACCTCCAGGAAGCGCTGGCCGGCCTCGTAGTAGAGCCAGCCCTTCTTCAGGGCCTGGGCGGCCGACATCTTGGTCTTGGTGCGTGGGTCCTCGAAGCCGCAGAAGGCCTTCTGGGCCAGGTTGATGCGGTCCACCATGATCTTGTCCACCAGGCCCTTGTTGACGGCGTCGGTGACAGGGAAGCGCTCACCGGTGCTGGGGTCGATGATGCCCCCGGTGCAGGCCTGCGCCTCCAGCAGCCGCTGCCCCGTGATGTTATCCACCAGGTTCCGGTGCATGGCCTCGGTGATGGACACCTTCTCCAGCGTCTCCGTGTCCAGGATGCCAGCCACGGGGCCCGTCTCCTCAGTGGGGTCTGACCAGGAGGCCAGCTGGGTCCTGGAGACGGCGGGGCTGATGGGGTAGGAGGAGGAGGATCCCACCGAGGAGGAACGGGAGCGGAAACCACCGGCGTTGCCCGAGAGCATGTCGGCGAACTCGGTGATGGAGAGCGTGCCGGCGCGGTACTGGTCCAGTGCCGAGCGGTCGATGAGGTTCTTGGCGATGGCATCATCGATGTCGTACTGGCGCCCGGAGCGGCGGTCGATGATCATGGACTTGACCACGCCGTCCGAGGAGGAGATGGTGATCTCCTCCCACTCGCACTCCTGCTCGGACAGCTCCAGGTACGTCTGGTGGTCAATCAGGCCCTTGCGGTAGGCCTCGTACACTGACATCTCCTTGCCCGTCTCGGGGTCCACGATGACCACTCGGCGCTTGCGCACGGAGGACTTGGAGGACGTCTTCCGCTCCCGCTTCTTCTCCTTCAGCGGCAAGAGACACAGGCCCGTCTGGGGGTCAGTGATACAACGCTCCATCAGCTGCAGGTAGGTGAGGTTCTCCTCCGTGTTAGGGTCAAAGAAGCCCTTGGTGTCGTCCGAGGGGTCGGTCAGGATCTCGTTCATCTCCTCATCGAAGAGGCCGCGCTTGTAGGCCACCTCCACGGGCAGCCGGTGGCTCTCCTCAGGGTCGATGATGCCGCCCGTGGCGATCTGGGCCTCCAGCAGGCGGATGCCGTGCTGCCGGAGAACCAGGCCCTTCTGCATGGCCTGGAAGAGGGAGATGGTGCTGCCCGAGTAGGGGTCTCTGTAGCCGGTGACGGCCTTCTCGGCAGACAGCAGCTGCTCGTGAAGCTCGGGGCCCACCACGCCCGCCTTCACGGCCTCGTGGACATACAGGCGCTGGTTCCGCACGGGGTCCACCAGGAAGCCAGTGGCCGCCTGCGCCTCCAGCAGGAGCGCAGCCGTTGTGGCTCTCAGCAGGCCCCGGCGCATGGCCTCGTAGATGGACACCTTCTCCTTGGTGTCCTCCAGGTAGATGCCGGCGAGGCAGCCACTGCCCTGCAGCAGCGTCCGCACGGAGCCCAGCTCCGAAAGGTCCTTGACCGTCGTCTTGCCGTCCTTGAGCTGCTCAAACTGGGCTCTGCTGAGGACCCCGGAAGCCAGGAGCTCGCTGGCTGGCACAGGGGCACGGAGGCCGCTGAAGGACAGCCTCTCCTGCCGCAGGGTCTCCACCTCCTCCACGATGGTAATGAGAATCTTGATGACCTTCTCCACGGTGACCTTGCCCGTGCGGAACTGACGCAACAGCTCCTGCCGCTGCTCCGCAGTGAAGTACTCAGAGCTGATGAGCTCCCACACCGTCACCGTCCTGCCCTTGAAGCCACCCACGGGGACCTCAACCGGGGTCTTTTCAAAGGTCTCACGGGCCTGCAGCTCTGAGTAGAGCTCCTCCTGCCGGGCCCGAGCAGCCTTTTCTGAGAGCGGCAGCAGGCTCAGCCCGGTCAGCTGGTCGGGCCGGCACCGCTGCTGGAGCTCGCCGTAGGTGGCCGGCTCCCCTGTGCTGGGGTCACTGTAGGCCTTGGCGTCGGCCCTTGGTGCCGACAGGGCCCTGCTGGTCTCCTCATCCAGGCAGCCTCGGGCGCAGGCGACATCCAGGGGCACGCGGTGGCTCTTGCTGGGGTCCACGATGCCGCCCGTGGACAGCTGGGCGTCCAACAGGCGCAGGCCCTGCTCCCGGGGAATGAGGCCCTTCTTCAGGGCCTGGAACAGGGAGACGCTCTGCCCTGTGTAGGGGTCCCTGTACCCTGTCACAGCCTTCTCGGCTGATAGCAGCTTCTCATGAAACTCGGGGCCCACCAGGCCAGCACGCACTGCCTCGTCCACGGTCAGCCGGGCGCTGGTGGCGGGGTCGATGATGTGCCCGGTGCCGGCCTGGGCTTCCAACAGGGCCACGGCCATGTCGGATGGCAGCAGGTCTTTCTTCAGGGCATTGTAGATACTCAGCTTCTGCCCCGCCTCCTCCAGCCATACACCCGCGATGACGTTGGCACCCCGGAGAGCCCGCCGCACAGTGTCCACCTCGGCTACGTCTCGCACAGAGCGCTCACCTCGCTGCAGCTGCTGGTAGAGCTCGCGGTCGATGACCCTGCTCTCCAGCAGCTCGGCGGCTGGCACCAGGCTGCGCAGGCCCTCAAAGCAAAGCCGGCCCTTCTGCTCCTGCTCCTCCACCACCGTGATGATGATCTTGATGATCTTCTCCACTGTGATCCGGCCCGTGCGGAACTGCCGCAGCAGGTCCCGCCGCTGCTCTGCCGTGAAGTATTCCGAGTTGATGATCTCCCAAATGGTCACCGTCTTGCCCTGGAACTTGCCGAACGGCGCAGACACGGTGGCCTTCTCAAAGACGTCCCGGGCCTCGGAGTCAGTGTAGACCAGCTCCCCGCCCTTGGCAGCCTTATCCGTGAGTGGCAGAAGGCACAGGCCCGTCTCGGGGTCCTCCACGCAGCGCTCCAGTAGCTGCAGGTACGTGAGGTTCTCGTGCGTGTTG