Transcript asmbl_131952

Sequence
Transcript Sequence for observation asmbl_131952 of TGE0056966:
GGTTGGAATTGCTTTTATTGGGGGCGGATACCGCAAGGCCCCGCCCACGGTCAGGTTAGTGTTCTGCCCTTGCAGAGGCGCCAGCAGCCTGACACCTCCACCTGCCACCCGCCCGGGGTTAGTGGAACATGCAAAGCTCAGAGGGTGGAGGCAGGGGTGGTCGCTGCTGAGACCAGGGCTGGGTGCAACAGGAGGGTCAGCACAGAGCCTGGCTGGTGTCCCTGGGCCCAAAGGGGGCTGGGGCTCCATGGGAGAGAGACGGGCAGGCGGCACCCCAGTGTGGGGCTCCACAAGCTGGAGGGGCCCCTGGACCCACCAGGAGGACAGGTCTGCAGTTCCCAGCCATGCCGGCTGGAACGTCCGCCTCCCCACTGGGTCTGGGTCCTCGGGGCCTGGGGTTAGAGGCCGACATGGAAGGCACTTACTAGGGGAACAGAGGCTGGAGGCTGACGCCGGAGGCCAGGGGTCTCAGGAGTGAGTGTGGGGGGTGAGCTGGAAAGCACAGATCAGACAGCACTGTGGGGGCTGGGCCCGAGGGCCTCGTCTTCCCATGGGGAAGGGGCTTCTCTGGGTAGACTGGGAGAGAGGCTGACTGGGGCCCCCCGTCCCCAGCAAGGCCCACCGTGCAGGCCAGTGCTAGAAACACCAGGGCCCTCTACAGACAGGGTTGGGCCCAGCTGCCCTGTGCAGCTAGGACTGGCAGGCGGGCTACCCTGGGAAGACAGGAGGGTGGGCTGGGGCCCAGCTTGGGACCCTCCAAGGCACCTGGCTGTGTGAGTGGCAGGTAGAAGGGAGTGAGGAGACCCGAGGGGGTGAGGCGGCCAGCAGGGCTGGGCCAGCCCTGTCCCCCAAGATACAGGCTGTCTGGACAGCAGATATATATTAATATATTAGTCTGGTCTTTTTGGTTAAACTTTAGGCACCACTTGGGAGGAAGACACCTTTAAGCGTTGAAAACGGCCCCCGCGCCTCGGTGGGAGCCGGGCTGGGCCGCATGCAGAGCGGGGTGGGCGCAGGCAGCCTCAGGCCACGGCAGACTCAGGGCCCCCCAGGGAGGCCGAGGACCCCGAGGCGTAGCGGCGGCCGTAGCCCGAGGAGGAGTAGGAGGATGAAGAGAAGGTCATGGAGAAGCCGGAGCCGGTGGCGTCAAAGCTGCCGCGGCGGGAGCCGGCCCGGGAGCCGGTGCGCGAGCCGGTGCGGGAGCCAGCGGTAGAGCCGGAGCCGCTGACGCTGTAGGGGCTGTAGTAGCCCTTGGTGGACTGCGCGGCAGCCTCCAGCAGCCGCAGCCCCGTGCCCTCCTCCACCATGCTGCGGTCCAGCGCGTCCTTATAGGAGATCTTGAGCTTGGTCTTAGGGCAGGTGAGGTACTTGGAGTAGGCGCCCACGTCACGCAGCTTCTGTGCGGTGCGGGCGTCCACCGTGCCGCGCTGCAGGGCCTCGTCCAGGGGCACGCGGCCCGGCGTGTCGGGCTCGATCAAGCCGCCGGTCAGGTACTGCACCTCCAGGAAGCGCTGGCCGGCCTCGTAGTAGAGCCAGCCCTTCTTCAGGGCCTGGGCGGCCGACATCTTGGTCTTGGTGCGTGGGTCCTCGAAGCCGCAGAAGGCCTTCTGGGCCAGGTTGATGCGGTCCACCATGATCTTGTCCACCAGGCCCTTGTTGACGGCGTCGGTGACAGGGAAGCGCTCACCGGTGCTGGGGTCGATGATGCCCCCGGTGCAGGCCTGCGCCTCCAGCAGCCGCTGCCCCGTGATGTTATCCACCAGGTTCCGGTGCATGGCCTCGGTGATGGACACCTTCTCCAGCGTCTCCGTGTCCAGGATGCCAGCCACGGGGCCCGTCTCCTCAGTGGGGTCTGACCAGGAGGCCAGCTGGGTCCTGGAGACGGCGGGGCTGATGGGGTAGGAGGAGGAGGATCCCACCGAGGAGGAACGGGAGCGGAAACCACCGGCGTTGCCCGAGAGCATGTCGGCGAACTCGGTGATGGAGAGCGTGCCGGCGCGGTACTGGTCCAGTGCCGAGCGGTCGATGAGGTTCTTGGCGATGGCATCATCGATGTCGTACTGGCGCCCGGAGCGGCGGTCGATGATCATGGACTTGACCACGCCGTCCGAGGAGGAGATGGTGATCTCCTCCCACTCGCACTCCTGCTCGGACAGCTCCAGGTACGTCTGGTGGTCAATCAGGCCCTTGCGGTAGGCCTCGTACACTGACATCTCCTTGCCCGTCTCGGGGTCCACGATGACCACTCGGCGCTTGCGCACGGAGGACTTGGAGGACGTCTTCCGCTCCCGCTTCTTCTCCTTCAGCGGCAAGAGACACAGGCCCGTCTGGGGGTCAGTGATACAACGCTCCATCAGCTGCAGGTAGGTGAGGTTCTCCTCCGTGTTAGGGTCAAAGAAGCCCTTGGTGTCGTCCGAGGGGTCGGTCAGGATCTCGTTCATCTCCTCATCGAAGAGGCCGCGCTTGTAGGCCACCTCCACGGGCAGCCGGTGGCTCTCCTCAGGGTCGATGATGCCGCCCGTGGCGATCTGGGCCTCCAGCAGGCGGATGCCATGGTCCTTCAGGATCAGGCCCTTCTTCATGGCCTGGAAGAGGGAGATGAGCTTCCCAGAGTAGGGGTCCTTGTACCCAGTGACGGCGCGCTCGGCCGACAGCAGCTTGTCCTTGAACTCGGGGCCCACAATGCCCATACGCACAGCCTCCTCCACCGTCAGCTTCAGTCCCTTGATGGGGTCGATGACGTAACCGGTGGCCGCCTGCGCCTCCAGGAGCTCAAAGGCTGTGCCGGGGCGGATGATGCCCTTCTTCATGGCCTGGTACACCGAGAGCCGTTCCTTGGTGGCGTCCACGAAGACACCAGCGATGCAGCTGGTGCCTTCCAGGAACTTCTGCAAGTTCTTGGTGACCTCCTCGATGGAGGTCAGGCCCTCCCGCAGCTGCAGCGCCGTGGCCTCGTCCATGACCTGCGAGCGCACCAGCTCCTCCATGGTGATCTGCTTCCGCAGGCCACGGAAGGTCAGCTTGCGGGCGTCCGACAGTGGCAGGAGCAGCTGGCCGGTGCCGTCGTCACGACGGCACCGCCTGAGCAGCTGCGTGTAGCTGAGGCGCTCGTCGGTGGACGGGTCCACGTAGCTGCGCACCTCGCTGGGCTCTGACAGCTGGTCGTGCGTGTCCTTGTTGAGGTAGCCACGCTGGTAAGCCACCTCCAGGGGAAGGTGGAAGCCCAGGCGGGGGTCCACGATGCCGCCGGTGGCCAGCTGGGCATCCAGCAGCCGCAGGGCCTCCTCAGTAGGGATCAGCTCCTTCTTCATGGCCTGGAAGAGCGAGATGGTCTGCTCGGTGTAGGGGTCACGGTAGCCGGTGACCGCCCGCTCAGCCGAGAGCAGGCGGTCGTGCAGCTCGGGCCCCACGAGGCCCTTCCGCACAGCCTCATCCACAGTCAGCCGCTCCCCCTTCACCGGGTCCAGCAGGAAGCCTGTGGCTGCCTGTGCCTCCAGCAGCAGGCGGGCCACCTCGGCACTCAGCAGCCCTTTCTTGAGAGCCTGGTAGATGCTCAGTGTCTGCCTGGAACCGGGCAGGTAGACACCAGCCACGGAGCCCGTGCCATAGAGGTAGCACCAGGCGGACTCCGCCTCGAGAGCCTCACGGAGGCTCCTGGTGCCCTCCCGGAGCAGGTTGTAGGTCTCGAGAGAGATGATCCGAGCCTCGAACAGGTCCTCAGCCGTGAGGCGGCGGCGCACGTAGTCGTAGGAGGCCAGACCCTGCTGGCGGATGATCTCTGTCTTCTCAATGATCTCGATGATGATGATGATCATGCGTTCCTTGGTCACCCGGCCGGCCTGGAAGTCAGCCATCAGCTGGGCCCGCTGCTCCTCGGGGATCAGGTCCGACTGCATCACCTCCCACAGGGACATGGTGGAGCCGCCGTGGCTGCCGCCGCCGGGAATGTCGATCTGTGTCTCTTCAAATGCCCTTCTTGTCTCCTCCTCAGTGTACACCTGCGTGGTCTCCACCACCTCAGCCTTCTCCGCCCCTTTCAGTGGCAGAAGGCGCAAGCCCGTCTCGGGGTCCTCCACGCACCGCTCCAGCAGCTGCCTGTACGTGAGGTTCTCATGCGTGTTG