Transcript asmbl_128514

Sequence
Transcript Sequence for observation asmbl_128514 of TGE0056965:
GCTGGAGAAGCAGCGGCAGCTGGCGGAAGGCACCGCGCAGCAGCGCCTGGCCGCGGAGCAGGAGTTGATCCGGCTGCGGGCCGAGACGGAGCAGGGGGAGCAGCAGCGGCAGCTGCTGGAGGAGGAGCTGGCCCGGCTGCAGCGTGAGGCGGCTGCAGCCACGCAGAAACGGCAGGAGCTGGAAGCCGAGCTGGCCAAGGTGCGGGCCGAGATGGAGGTGCTGCTGGCCAGCAAGGCGAGGGCTGAGGAGGAGTCGCGCTCCACCAGCGAGAAGTCCAAGCAGAGGCTGGAGGCCGAGGCCGGCCGGTTCCGCGAGCTGGCCGAGGAGGCCGCCCGCCTGCGTGCCCTGGCGGAAGAGGCCAAGCGGCAGCGGCAGCTGGCCGAGGAAGACGCGGCGCGGCAGCGGGCCGAGGCGGAGCGGGTGCTTGCGGAGAAGCTGGCCGCCATCGGCGAGGCCACGCGGCTCAAGACGGAGGCGGAGATCGCGCTCAAGGAGAAGGAGGCGGAGAACGAGCGCCTGCGGCGGCTGGCGGAGGACGAGGCCTTCCAGCGGCGGCGGCTGGAGGAGCAGGCCGCGCAACACAAGGCTGACATCGAGGAGCGCCTGGCCCAGCTGCGCAAGGCATCGGACAGCGAGCTGGAGCGGCAGAAGGGGCTGGTGGAGGACACGCTGAGGCAGCGGCGGCAGGTGGAGGAGGAGATCCTGGCGCTGAAGGCGAGCTTCGAGAAGGCGGCCGCTGGCAAGGCGGAGCTGGAGCTGGAGCTGGGACGCATCCGCAGCAACGCGGAGGACACGCTGCGCAGCAAGGAGCAGGCCGAGCTGGAGGCTGCGAGGCAGCGGCAGCTGGCGGCGGAGGAGGAGCGGCGGCGCCGTGAGGCTGAGGAGCGCGTGCAGAAGAGCCTGGCGGCCGAGGAGGAGGCCGCACGGCAGCGGAAGGCGGCGCTGGAGGAAGTCGAGCGGCTGAAAGCCAAGGTGGAGGAGGCGCGGCGCCTGCGGGAGCGAGCGGAGCAGGAGTCGGCGCGGCAGCTGCAGCTGGCCCAGGAGGCCGCCCAGAAGCGGCTGCAGGCGGAAGAGAAGGCACACGCCTTCGCGGTGCAGCAGAAGGAGCAGGAGCTACAGCAGACGCTGCAGCAGGAGCAGAGCGTGCTGGACCAGCTGCGCGGCGAGGCGGAGGCGGCCCGGCGGGCGGCTGAGGAGGCGGAGGAGGCCCGGGTGCAGGCGGAGCGTGAGGCGGCGCAGTCCCGGCGGCAGGTGGAAGAGGCCGAGCGGCTGAAGCAGTCGGCAGAGGAGCAGGCACAGGCCCGGGCTCAGGCACAGGCGGCTGCAGAGAAGCTGCGCAAGGAGGCCGAGCAAGAGGCGGCGCGGCGGGCACAGGCGGAGCAGGCGGCCCTGCGGCAGAAGCAGGCAGCTGACGCGGAGATGGAGAAGCATAAGAAATTCGCCGAGCAGACGCTGCGGCAGAAGGCGCAGGTGGAGCAGGAGCTGACAACACTGCGGCTGCAGCTGGAGGAGACCGACCACCAGAAGAACCTGCTGGACGAGGAGCTGCAGCGGCTGAAGGCGGAGGCCACGGAGGCCGCACGCCAGCGCAGCCAGGTGGAGGAGGAGCTCTTCTCGGTGCGCGTGCAGATGGAGGAGCTGAGCAAGCTCAAGGCACGCATCGAGGCTGAGAACCGCGCACTCATCTTGCGTGACAAGGACAATACGCAGCGCTTCCTGCAGGAGGAGGCTGAGAAGATGAAGCAGGTGGCGGAGGAGGCCGCGCGGCTGAGTGTGGCGGCCCAAGAGGCTGCGCGACTGCGGCAGCTGGCAGAGGAGGACCTGGCACAGCAGCGGGCCTTGGCAGAGAAGATGCTCAAGGAGAAGATGCAGGCGGTGCAGGAGGCCACGCGACTCAAGGCTGAGGCGGAACTGCTGCAGCAGCAGAAGGAGCTTGCGCAGGAGCAGGCGCGGCGGCTGCAGGAGGACAAGGAGCAGATGGCGCAGCAGCTGGCGGAGGAGACGCAGGGCTTCCAGCGGACGCTGGAGGCCGAGCGGCAGCGGCAGCTGGAGATGAGCGCTGAGGCTGAGCGCCTCAAGCTGCGTGTGGCCGAGATGAGCCGAGCCCAGGCCCGCGCTGAGGAGGACGCCCAGCGCTTCCGGAAGCAGGCGGAGGAGATCGGTGAGAAGCTGCACCGCACGGAGCTCGCCACCCAGGAGAAGGTGACCCTGGTGCAGACACTGGAGATCCAGCGACAGCAGAGTGACCATGATGCCGAGCGCCTGCGGGAGGCCATCGCTGAGCTGGAGCGTGAGAAGGAGAAGCTCCAACAGGAGGCCAAACTGCTGCAGCTCAAGTCTGAGGAGATGCAGACGGTGCAGCAGGAGCAGCTGCTGCAGGAGACGCAGGCCCTGCAGCAAAGCTTCCTCTCTGAAAAGGACAGCCTGCTACAGCGGGAGCGCTTCATCGAGCAGGAGAAGGCCAAGCTGGAGCAGCTCTTCCAGGACGAGGTGGCCAAGGCACAGCAGCTGCGTGAGGAGCAGCAGCGGCAGCAGCAGCAGATGGAGCAGGAACGGCAGCGGCTGGTGGCCAGCATGGAGGAGGCGCGGCGGCGGCAGCATGAGGCCGAGGAGGGCGTGCGGCGCAAGCAGGAGGAGCTGCAGCAGCTGGAGCAGCAGCGGCGGCAGCAGGAGGAGCTGCTGGCTGAGGAGAACCAGAGGCTGCGTGAGCAGCTGCAGCTCCTGGAGGAGCAGCACCGGGCCGCGCTGGCGCACTCAGAGGAGGTCACTGCCTCGCAGGTGGCTGCCACAAAGACCCTGCCCAATGGCCGGGATGCACTTGATGGCCCCGCGGCAGAGGCAGAGCCGGAGCACAGCTTCGATGGCCTGCGGCGGAAGGTGTCAGCTCAGAGGCTGCAGGAGGCCGGCATCCTGAGTGCGGAGGAGCTGCAGCGGTTGGCGCAGGGCCACACCACGGTGGACGAGCTCGCACGGCGGGAAGACGTGCGCCACTACCTGCAGGGCCGCAGCAGTATCGCAGGGCTGTTGCTGAAGGCCACCAATGAGAAGCTGAGTGTTTACGCCGCCCTGCAGAGGCAGCTGCTGAGTCCCGGCACGGCCCTCATCCTGCTGGAGGCGCAGGCGGCCTCAGGCTTCCTGCTGGACCCTGTGCGGAACCGGCGGCTGACCGTCAACGAGGCTGTGAAGGAGGGTGTGGTGGGCCCCGAGCTGCACCACAAGCTGCTGTCGGCCGAGCGCGCCGTCACTGGCTACAAGGACCCCTACACTGGCCAGCAGATCTCTCTCTTCCAAGCCATGCAGAAGGGCCTCATCGTCCGGGAGCACGGCATCCGCCTGCTGGAGGCCCAGATCGCCACGGGCGGCGTTATCGACCCCGTGCACAGCCACCGCGTGCCCGTGGACGTGGCCTACCGGCGCGGCTACTTCGACGAGGAGATGAACCGCGTCCTGGCGGACCCCAGCGACGACACCAAGGGCTTCTTTGACCC