Transcript asmbl_127950

Sequence
Transcript Sequence for observation asmbl_127950 of TGE0056440:
CCCGGCCCAAGTCTCCCACTAGGGATGCAGATGGATTCGGTGTGAAGGGCTGGCTGCTGTTGCCTCCGGCTCTTGAAAGTCAAGTTCAGGTGGTGCTGAGACTCCCTGGGGGCTGCAGCGCTGTGAGGCGTGCAAAGACTCCAGAATTGGAGGCATGATGAAGACTCTGCTGCTGTTTGTGGGGCTGCTGCTGACCTGGGAGAGTGGGCAGGTCCTGGGGGACCAGACGGTCTCAGACAATGAGCTCCAGGAAATGTCCAATCAGGGAAGTAAGTACGTCAATAAGGAAATTCAAAATGCTGTCAACGGGGTGAAACAGATAAAGACTCTCATAGAAAAAACAAACGAAGAGCGCAAGACACTGCTCAGCAACCTAGAAGAAGCCAAGAAGAAGAAAGAGGATGCCCTAAATGAGACCAGGGAATCAGAGACAAAGCTGAAGGAGCTCCCAGGAGTGTGCAATGAGACCATGATGGCCCTCTGGGAAGAGTGTAAGCCCTGCCTGAAACAGACCTGCATGAAGTTCTACGCACGCGTCTGCAGAAGTGGCTCAGGCCTGGTTGGCCGCCAGCTTGAGGAGTTCCTGAACCAGAGCTCGCCCTTCTACTTCTGGATGAATGGTGACCGCATCGACTCCCTGCTGGAGAACGACCGGCAGCAGACGCACATGCTGGATGTCATGCAGGACCACTTCAGCCGCGCGTCCAGCATCATAGACGAGCTCTTCCAGGACAGGTTCTTCACCCGGGAGCCCCAGGATACCTACCACTACCTGCCCTTCAGCCTGCCCCACCGGAGGCCTCACTTCTTCTTTCCCAAGTCCCGCATCGTCCGCAGCTTGATGCCCTTCTCTCCGTACGAGCCCCTGAACTTCCACGCCATGTTCCAGCCCTTCCTTGAGATGATACACGAGGCTCAGCAGGCCATGGACATCCACTTCCATAGCCCGGCCTTCCAGCACCCGCCAACAGAATTCATACGAGAAGGCGACGATGACCGGACTGTGTGCCGGGAGATCCGCCACAACTCCACGGGCTGCCTGCGGATGAAGGACCAGTGTGACAAGTGCCGGGAGATCTTGTCTGTGGACTGTTCCACCAACAACCCCTCCCAGGCTAAGCTGCGGCGGGAGCTCGACGAATCCCTCCAGGTCGCTGAGAGGTTGACCAGGAAATACAACGAGCTGCTAAAGTCCTACCAGTGGAAGATGCTCAACACCTCCTCCTTGCTGGAGCAGCTGAACGAGCAGTTTAACTGGGTGTCCCGGCTGGCAAACCTCACGCAAGGCGAAGACCAGTACTATCTGCGGGTCACCACGGTGGCTTCCCACACTTCTGACTCGGACGTTCCTTCCGGTGTCACTGAGGTGGTCGTGAAGCTCTTTGACTCTGATCCCATCACTGTGACGGTCCCTGTAGAAGTCTCCAGGAAGAACCCTAAATTTATGGAGACCGTGGCGGAGAAAGCGCTGCAGGAATACCGCAAAAAGCACCGGGAGGAGTGAGATGTGGATGTTGCTTTTGCACCTACGGGGGCATCTGAGTCCAGCTCCCCCCAAGATGAGCTGCAGCCCCCCAGAGAGAGCTCTGCACGTCACCAAGTAACCAGGCCCCAGCCTCCAGGCCCCCAACTCCGCCCAGCCTCTCCCCGCTCTGGATCCTGCACTCTAACACTCGACTCTGCTGCTCATGGGAAGAACAGAATTGCTCCTGCATGCAACTAATTCAATAAAACTGTCTTGTGAGCTGATCGCTTGGAGGGTCCTCTTTTTATGTTGAGTTGCTGCTTCCCGGCATGCCTTCATTTTGCTATGGGGGGCAGGCAGGGGGGATGGAAAATAAGTAGAAACAAAAAAGCAGTGGCTAAGATGGTATAGGGACTGTCATACCAGTGAAGAATAAAAGGGTGAAGAATAAAAGGGATATGATGACAAGGTTGATCCACTTCAAGAATTGCTTGCTTTCAGGAAGAGAGATGTGTTTCAACAAGCCAACTAAAATATATTGCTGCAAATGGAAGCTTTTCTGTTCTATTATAAAACTGTCGATGTATTCTGACCAAGGTGCGACAATCTCCTAAAGGAATACACTGAAAGTTAAGGAGAAGAATCAGTAAGTGTAAGGTGTACTTGGTATTATAATGCATAATTGATGTTTTCGTTATGAAAACATTTGGTGCCCAGAAGTCCAAATTATCAGTTTTATTTGTAAGAGCTATTGCTTTTGCAGCGGTTTTATTTGTAAAAGCTGTTGATTTCGAGTTGTAAGAGCTCAGCATCCCAGGGGCATCTTCTTGACTGTGGCATTTCCTGTCCACCGCCGGTTTATATGATCTTCATACCTTTCCCTGGACCACAGGCGTTTCTCGGCTTTTAGTCTGAACCATAGCTGGGCTGCAGTACCCTACGCTGCCAGCAGGTGGCCATGACTACCCGTGGTACCAATCTCAGTCTTAAAGCTCAGG