Transcript asmbl_127345

Sequence
Transcript Sequence for observation asmbl_127345 of TGE0056435:
CATGAATCTGTTGTGCTTTGCCACAGTTGACATTGCACTTCAGGAGGATTATTTTCTTTTATGAAGGTATGTAAGTGTCCTTGCATGCCTAGACTAAAATGAGGTTAGGGCTTCATTTGGCAAAGACGTTTGGATTCTGATTGCAAGTTAACCCTGAGTCCGATGCTGAAAAACGAAAAATGGTTTAAGATGTGCCCCTGCCCTTGGAGTCCACAATCCAGTTAGGGAAATAAGATAGTATATTCTTTATTTATTCCTGTCTTTCCTCAGAATGGGTGGAAGCCCAGCGATAAGATGTTAGCATAAGGCCTTTCGTAATTCAAACCCTGTATAAATACTTTCAAATGTCAGATGTTGATATAAAAATGATTTGGTCACCTGAAATTTGGGAATCTAAGCCAGGGTTCAAGGGCACAGCCACTGTGCTAAGTAATCTCAGCCACAGCTACTGGCCAAGAACACATTTTGTCCTGTACGGCACGTGATTTTCCTGTGCCATTTGGCTTTGCATGAGGTGCCAACCCTATTGGGCCTGTGAGACGCTGAGACTGAATGGCTCCCAAGATCCCTGCTTGTAGTACTGGCAGTGGTCATCACAATGGCAGACACCCCCAAGTTAGATTATACTTAGTTGAAAGCCTTTAAACTGGATACTTAGAATTCCTTTGGGTTTTGTTTTGTTTTGATCATGTTTATTGCATTTCATCAAGTATGTTTTGTTGTGAGATAGAGTCAGGTACGTAAAGAGCTTCTCATTTGTGATGTATCCGATGCCAGGTGGCACATTATCAGGATGTAACCTGGATTGTTTGTACAGACATGGTCTGTGGGGAAATCCTAAGTAAGGGGGAGGCAAAGGCAGGACGGAGGTGAAGAGTATAGACTCCGGAGTTGCAAAGAACTGAATCAGAATTCTGGCGTGGCCTTTTCCTTGCAGTGAGACTTGGGGCATGTTACATAATCTCTCTGATCTCTGAGTTCCCACATCTGTGAAATAGTGATTATTATAACACGTATCCCATAGGGTTATTGTGAGAGTTAAATGGGATCATTCATATAAAACATTTCTGTTTAAAGTATTATTACTGCTAAGAAGGGGTTAGCAACCACTGAAGTCACGCATGTGCTAGAGGAAGCTGCTACAGTCTCTACCTGAGCCATTGGTCAATTGTTGTCGATGGTTGACACCTTCCCATTTTCACAGTGAAGTGAGTATTCTAAATGCCACATCTTGTCACTGAGGTTCATGATTAAGTAGATCAGCTAGCATTGCTTATTCCCTTCTAGCCTGTGACTGTGACCCCAGGGGCATTGAGACGCCACAGTGTGACCAGTCCACGGGCCAGTGTGTCTGCGTTGAGGGTGTTGAGGGTCCACGCTGTGACAAGTGCACGCGAGGGTACTCGGGGGTCTTCCCTGACTGCACACCCTGCCACCAGTGCTTTGCTCTCTGGGATGTGATCATTGCCGAGCTGACCAACAGGACACACAGATTCCTGGAGAAAGCCAAGGCCTTGAAGATCAGTGGTGTGATCGGGCCTTACCGTGAGACTGTGGACTCGGTGGAGAGGAAAGTCAGCGAGATAAAAGACATCCTGGCGCAGAGCCCCGCAGCAGAGCCACTGAAAAACATTGGGAATCTCTTTGAGGAAGCAGAGAAACTGATTAAAGATGTTACAGAAATGATGGCTCAAGTAGAAGTGAAATTATCTGACACAACTTCCCAAAGCAACAGCACAGCCAAAGAACTGGATTCTCTACAGACAGAAGCCGAAAGCCTAGACAACACTGTGAAAGAACTTGCTGAACAACTGGAATTTATCAAAAACTCAGATATTCGGGGTGCCTTGGATAGCATTACCAAGTATTTCCAGATGTCTCTTGAGGCAGAGGAGAGGGTGAATGCCTCCACCACAGAACCCAACAGCACTGTGGAGCAGTCAGCCCTCATGAGAGACAGAGTAGAAGACGTGATGATGGAGCGAGAATCCCAGTTCAAGGAAAAACAAGAGGAGCAGGCTCGCCTCCTTGATGAACTGGCAGGCAAGCTACAAAGCCTAGACCTTTCAGCCGCTGCCGAAATGACCTGTGGAACACCCCCAGGGGCCTCCTGTTCCGAGACTGAATGTGGCGGGCCAAACTGCAGAACTGACGAAGGAGAGAGGAAGTGTGGGGGGCCTGGCTGTGGTGGTCTGGTTACTGTTGCACACAACGCCTGGCAGAAAGCCATGGACTTGGACCAAGATGTCCTGAGTGCCCTGGCTGAAGTGGAACAGCTCTCCAAGATGGTCTCTGAAGCAAAACTGAGGGCAGATGAGGCAAAACAAAGTGCTGAAGACATTCTGTTGAAGACAAATGCTACCAAAGAAAAAATGGACAAGAGCAATGAGGAGCTGAGAAATCTAATCAAGCAAATCAGAAACTTTTTGACCCAGGATAGTGCTGATTTGGACAGCATTGAAGCAGTTGCTAATGAAGTATTGAAAATGGAGATGCCTAGCACCCCACAGCAGTTACAGAACTTGACAGAAGATATACGTGAACGAGTTGAAAGCCTTTCTCAAGTAGAGGTTATTCTTCAGCATAGTGCTGCTGACATTGCCAGAGCTGAGATGTTGTTAGAAGAAGCTAAAAGAGCAAGCAAAAGTGCAACAGATGTTAAAGTCACTGCAGATATGGTAAAGGAAGCTCTGGAAGAAGCAGAAAAGGCCCAGGTCGCAGCAGAGAAGGCAATTAAACAAGCAGATGAAGACATTCAAGGAACCCAGAACCTGTTAACTTCGATTGAGTCTGAAACAGCAGCTTCTGAGGAAACCTTGTTCAACGCGTCCCAGCGCATCAGCGAGTTAGAGAGGAATGTGGAAGAACTTAAGCGGAAAGCTGCCCAAAACTCCGGGGAGGCAGAATATATTGAAAAAGTAGTATATACTGTGAAGCAAAGTGCAGAAGATGTTAAGAAGACTTTAGATGGTGAACTTGATGAAAAGTATAAAAAAGTAGAAAATTTAATTGCCAAAAAAACTGAAGAGTCAGCTGATGCCAGAAGGAAAGCCGAAATGCTACAAAATGAAGCAAAAACTCTTTTAGCTCAAGCAAATAGCAAGCTGCAACTGCTCAAAGATTTAGAAAGAAAATATGAAGACAATCAAAGATACTTAGAAGATAAAGCTCAAGAATTAGCAAGACTGGAAGGAGAAGTCCGTTCACTCCTAAAGGATATAAGCCAGAAAGTTGCTGTGTATAGCACATGCTTGTAACAGAGGAGAATAAAAAATGGCTGAGGTGAACAAGGTAAAACAACTACATTTTAAAAACTGACTTAATGCTCTTCAAAATAAAACATCACCTATTTAATGTTTTTAATCACATTTTGTATGGAGTTAAATAAAGTACAGTGC