Transcript asmbl_127344

Sequence
Transcript Sequence for observation asmbl_127344 of TGE0056432:
ATTCGGCTTTCAAACAAAAGAGGCGCCCCGGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGGCCGCCCGCCCCTTCAGCCCCGGCTCTCCGTATGCGCATGAGCAGAGGCGCCTCCCTCTGTTCCTCCCAAGGCTAAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCGCGTCGCCGGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGCATGGGGCTTCTCCAGTTGCTAGCTTTCAGTTTCTTAGCCCTGTGCAGAGCCCGAGTGCGCGCTCAGGAACCCGAGTTCAGCTACGGCTGCGCAGAAGGCAGCTGCTATCCCGCCACGGGCGACCTTCTCATCGGCCGAGCACAGAAGCTTTCGGTGACCTCGACGTGCGGGCTGCACAAGCCCGAACCCTACTGTATCGTCAGCCACTTGCAGGAGGACAAAAAATGCTTCATATGCAATTCCCAAGATCCTTATCATGAGACCCTGAATCCTGACAGCCATCTCATTGAAAATGTGGTCACTACATTTGCTCCAAACCGCCTTAAGATTTGGTGGCAATCTGAAAATGGTGTGGAAAATGTAACTATCCAACTGGATTTGGAAGCAGAATTCCATTTTACTCATCTCATAATGACTTTCAAGACATTCCGTCCAGCTGCTATGCTGATAGAACGATCGTCCGACTTTGGGAAAACCTGGGGTGTGTATAGATACTTCGCCTATGACTGTGAGGCCTCGTTTCCAGGCATTTCAACTGGCCCCATGAAAAAAGTCGATGACATAATTTGTGATTCTCGATATTCTGACATTGAACCCTCAACTGAAGGAGAGGTGATATTTCGTGCTTTAGATCCTGCTTTCAAAATAGAAGATCCTTATAGCCCAAGGATACAGAATTTATTAAAAATTACCAACTTGAGAATCAAGTTTGTGAAACTGCATACTTTGGGAGATAACCTTCTGGATTCCAGGATGGAAATCAGAGAAAAGTATTATTATGCAGTTTATGATATGGTGGTTCGAGGAAATTGCTTCTGCTATGGTCATGCCAGCGAATGTGCCCCTGTGGATGGATTCAATGAAGAAGTGGAAGGAATGGTTCACGGACACTGCATGTGCAGGCATAACACCAAGGGCTTAAACTGTGAACTCTGCATGGATTTCTACCATGATTTACCTTGGAGACCTGCTGAAGGCCGAAACAGCAACGCCTGTAAAAAATGTAACTGCAATGAACATTCCATCTCTTGTCACTTTGACATGGCTGTTTACCTGGCCACGGGGAACGTCAGCGGAGGCGTGTGTGATGACTGTCAGCACAACACCATGGGGCGCAACTGTGAGCAGTGCAAGCCGTTTTACTACCAGCACCCAGAGAGGGACATCCGAGATCCTAATTTCTGTGAACGATGTACGTGTGACCCAGCTGGCTCTCAAAATGAGGGAATTTGTGACAGCTATACTGATTTTTCTACTGGTCTCATTGCTGGCCAGTGTCGGTGTAAATTAAATGTGGAAGGAGAACATTGTGATGTTTGCAAAGAAGGCTTCTATGATTTAAGCAGTGAAGATCCATTTGGTTGTAAATCTTGTGCTTGCAATCCTCTGGGAACAATTCCTGGAGGGAATCCTTGTGATTCCGAGACAGGTCACTGCTACTGCAAGCGTCTGGTGACAGGACAGCATTGTGACCAGTGCCTGCCAGAGCACTGGGGCTTAAGCAATGATTTGGATGGATGTCGACCATGTGACTGTGACCTTGGGGGAGCCTTAAACAACAGTTGCTTTGCGGAGTCAGGCCAGTGCTCATGCCGGCCTCACATGATTGGACGTCAGTGCAACGAAGTGGAACCTGGTTACTACTTTGCCACCCTGGATCACTACCTCTATGAAGCGGAGGAAGCCAACTTGGGGCCTGGGGTTAGCATAGTGGAGCGGCAATATATCCAGGACCGGATTCCCTCCTGGACTGGAGCCGGCTTCGTCCGAGTGCCTGAAGGGGCTTATTTGGAGTTTTTCATTGACAACATACCATATTCCATGGAGTACGACATCCTAATTCGCTACGAGCCACAGCTACCCGACCACTGGGAAAAAGCTGTCATCACAGTGCAGCGACCTGGAAGGATTCCAACCAGCAGCCGATGTGGTAATACCATCCCCGATGATGACAACCAGGTGGTGTCATTATCACCAGGCTCAAGATATGTCGTCCTTCCTCGGCCGGTGTGCTTTGAGAAGGGAACAAACTACACGGTGAGGTTGGAGCTGCCTCAGTACACCTCCTCTGATAGCGACGTGGAGAGCCCCTACACGCTGATCGATTCTCTTGTTCTCATGCCATACTGTAAATCACTGGACATCTTCACCGTGGGAGGTTCAGGAGATGGGGTGGTCACCAACAGTGCCTGGGAAACCTTTCAGAGATACCGATGTCTAGAGAACAGCAGAAGCGTTGTGAAAACACCGATGACAGATGTTTGCAGAAACATCATCTTTAGCATTTCTGCCCTGTTACACCAGACAGGCCTGGCTTGTGAATGCGACCCTCAGGGTTCGTTAAGTTCCGTGTGTGATCCCAACGGAGGCCAGTGCCAGTGCCGGCCCAACGTGGTTGGAAGAACCTGCAACAGATGTGCACCTGGAACTTTTGGCTTTGGCCCCAGTGGATGCAAACCTTGTGAGTGCCATCTGCAAGGATCTGTCAATGCCTTCTGCAATCCCGTCACTGGCCAGTGCCACTGTTTCCAGGGAGTGTATGCTCGGCAGTGTGATCGGTGCTTACCTGGGCACTGGGGCTTTCCAAGTTGCCAGCCCTGCCAGTGCAATGGCCACGCCGATGACTGCGACCCAGTGACTGGGGAGTGCTTGAACTGCCAGGACTACACCATGGGTCATAACTGTGAAAGGTGCTTGGCTGGTTACTATGGCGACCCCATCATTGGGTCAGGAGATCACTGCCGCCCTTGCCCTTGCCCAGATGGTCCCGACAGTGGACGCCAGTTTGCCAGGAGCTGCTACCAAGATCCTGTTACTTTACAGCTTGCCTGTGTTTGTGATCCTGGATACATTGGTTCCAGATGTGACGACTGTGCCTCAGGATACTTTGGCAATCCATCAGAAGTTGGGGGGTCGTGTCAGCCTTGCCAGTGTCACAACAACATTGACACGACAGACCCAGAAGCCTGTGACAAGGAGACTGGGAGGTGTCTCAAGTGCCTGTACCACACGGAAGGGGAACACTGTCAGTTCTGCCGGTTTGGATACTATGGTGATGCCCTCCAGCAGGACTGTCGAAAGTGTGTCTGTAATTACCTGGGCACCGTGCAAGAGCACTGTAACGGCTCTGACTGCCAGTGCGACAAAGCCACTGGTCAGTGCTTGTGTCTTCCTAATGTGATCGGGCAGAACTGTGACCGCTGTGCGCCCAATACCTGGCAGCTGGCCAGTGGCACTGGCTGTGACCCATGCAACTGCAATGCTGCTCATTCCTTCGGGCCATCTTGCAATGAGTTCACGGGGCAGTGCCAGTGCATGCCTGGGTTTGGAGGCCGCACCTGCAGCGAGTGCCAGGAACTCTTCTGGGGAGACCCCGACGTGGAGTGCCGAGCCTGTGACTGTGACCCCAGGGGCATTGAGACGCCACAGTGTGACCAGTCCACGGGCCAGTGTGTCTGCGTTGAGGGTGTTGAGGGTCCACGCTGTGACAAGTGCACGCGAGGGTACTCGGGGGTCTTCCCTGACTGCACACCCTGCCACCAGTGCTTTGCTCTCTGGGATGTGATCATTGCCGAGCTGACCAACAGGACACACAGATTCCTGGAGAAAGCCAAGGCCTTGAAGATCAGTGGTGTGATCGGGCCTTACCGTGAGACTGTGGACTCGGTGGAGAGGAAAGTCAGCGAGATAAAAGACATCCTGGCGCAGAGCCCCGCAGCAGAGCCACTGAAAAACATTGGGAATCTCTTTGAGGAAGCAGAGAAACTGATTAAAGATGTTACAGAAATGATGGCTCAAGTAGAAGTGAAATTATCTGACACAACTTCCCAAAGCAACAGCACAGCCAAAGAACTGGATTCTCTACAGACAGAAGCCGAAAGCCTAGACAACACTGTGAAAGAACTTGCTGAACAACTGGAATTTATCAAAAACTCAGATATTCGGGGTGCCTTGGATAGCATTACCAAGTATTTCCAGATGTCTCTTGAGGCAGAGGAGAGGGTGAATGCCTCCACCACAGAACCCAACAGCACTGTGGAGCAGTCAGCCCTCATGAGAGACAGAGTAGAAGACGTGATGATGGAGCGAGAATCCCAGTTCAAGGAAAAACAAGAGGAGCAGGCTCGCCTCCTTGATGAACTGGCAGGCAAGCTACAAAGCCTAGACCTTTCAGCCGCTGCCGAAATGACCTGTGGAACACCCCCAGGGGCCTCCTGTTCCGAGACTGAATGTGGCGGGCCAAACTGCAGAACTGACGAAGGAGAGAGGAAGTGTGGGGGGCCTGGCTGTGGTGGTCTGGTTACTGTTGCACACAACGCCTGGCAGAAAGCCATGGACTTGGACCAAGATGTCCTGAGTGCCCTGGCTGAAGTGGAACAGCTCTCCAAGATGGTCTCTGAAGCAAAACTGAGGGCAGATGAGGCAAAACAAAGTGCTGAAGACATTCTGTTGAAGACAAATGCTACCAAAGAAAAAATGGACAAGAGCAATGAGGAGCTGAGAAATCTAATCAAGCAAATCAGAAACTTTTTGACCCAGGATAGTGCTGATTTGGACAGCATTGAAGCAGTTGCTAATGAAGTATTGAAAATGGAGATGCCTAGCACCCCACAGCAGTTACAGAACTTGACAGAAGATATACGTGAACGAGTTGAAAGCCTTTCTCAAGTAGAGGTTATTCTTCAGCATAGTGCTGCTGACATTGCCAGAGCTGAGATGTTGTTAGAAGAAGCTAAAAGAGCAAGCAAAAGTGCAACAGATGTTAAAGTCACTGCAGATATGGTAAAGGAAGCTCTGGAAGAAGCAGAAAAGGCCCAGGTCGCAGCAGAGAAGGCAATTAAACAAGCAGATGAAGACATTCAAGGAACCCAGAACCTGTTAACTTCGATTGAGTCTGAAACAGCAGCTTCTGAGGAAACCTTGTTCAACGCGTCCCAGCGCATCAGCGAGTTAGAGAGGAATGTGGAAGAACTTAAGCGGAAAGCTGCCCAAAACTCCGGGGAGGCAGAATATATTGAAAAAGTAGTATATACTGTGAAGCAAAGTGCAGAAGATGTTAAGAAGACTTTAGATGGTGAACTTGATGAAAAGTATAAAAAAGTAGAAAATTTAATTGCCAAAAAAACTGAAGAGTCAGCTGATGCCAGAAGGAAAGCCGAAATGCTACAAAATGAAGCAAAAACTCTTTTAGCTCAAGCAAATAGCAAGCTGCAACTGCTCAAAGATTTAGAAAGAAAATATGAAGACAATCAAAGATACTTAGAAGATAAAGCTCAAGAATTAGCAAGACTGGAAGGAGAAGTCCGTTCACTCCTAAAGGATATAAGCCAGAAAGTTGCTGTGTATAGCACATGCTTGTAACAGAGGAGAATAAAAAATGGCTGAGGTGAACAAGGTAAAACAACTACATTTTAAAAACTGACTTAATGCTCTTCAAAATAAAACATCACCTATTTAATGTTTTTAATCACATTTTGTATGGAGTTAAATAAAGTACAGTGC