Transcript asmbl_121148

Sequence
Transcript Sequence for observation asmbl_121148 of TGE0056962:
TGGTCCTGCTGGTCCCGCCGGTCCCCGTGGTGAAGTGGGTCTTCCAGGCCTCTCCGGCCCCGTTGGACCTCCTGGTAATCCTGGAGCAAACGGCCTTACTGGTGCCAAGGGTGCTGCTGGCCTTCCCGGCGTTGCTGGGGCTCCCGGCCTCCCTGGACCCCGCGGTATTCCTGGCCCTGTTGGTGCTGCCGGTGCTACTGGTGCCAGAGGACTTGTTGGTGAGCCTGGTCCAGCTGGCTCCAAAGGAGAGAGCGGTAACAAGGGTGAGCCCGGCTCTGCTGGGCCCCAAGGTCCTCCTGGTCCCAGTGGTGAAGAAGGAAAGAGAGGCCCTAATGGGGAAGCTGGATCTGCCGGCCCTCCAGGACCTCCTGGGCTGAGAGGTAGTCCTGGTTCTCGTGGTCTTCCTGGAGCTGATGGCAGAGCTGGCGTCATGGGCCCTCCTGGTAGTCGTGGTGCAAGTGGCCCTGCTGGAGTCCGAGGACCTAATGGAGATGCTGGTCGCCCTGGGGAGCCTGGTCTCATGGGACCCAGAGGTCTTCCTGGTTCCCCTGGAAATATCGGCCCCGCTGGAAAAGAAGGTCCTGTCGGCCTCCCTGGCATCGACGGCAGGCCTGGCCCAATTGGCCCAGCTGGAGCAAGAGGAGAGCCTGGCAACATTGGATTCCCTGGACCCAAAGGCCCCACTGGTGATCCTGGCAAAAACGGTGATAAAGGTCATGCTGGTCTTGCTGGTGCTCGGGGTGCTCCAGGTCCTGATGGAAACAATGGTGCTCAGGGACCTCCTGGACCACAGGGTGTTCAAGGTGGAAAAGGTGAACAGGGTCCCCCTGGTCCTCCAGGCTTCCAGGGTCTGCCTGGCCCCTCAGGTCCCGCTGGTGAAGTTGGCAAACCAGGAGAAAGGGGTCTCCATGGTGAGTTTGGTCTCCCTGGTCCTGCTGGTCCAAGAGGGGAACGCGGTCCCCCAGGTGAGAGTGGTGCTGCCGGTCCTACTGGTCCTATTGGAAGCCGAGGTCCTTCTGGACCCCCAGGGCCTGATGGAAACAAGGGTGAACCTGGTGTGGTTGGTGCTGTGGGCACTGCTGGTCCATCTGGTCCTAGTGGACTCCCAGGAGAGAGGGGTGCTGCTGGCATACCTGGAGGCAAGGGAGAAAAGGGTGAACCTGGTCTCAGAGGTGAAATTGGTAACCCTGGCAGAGATGGTGCTCGTGGTGCTCCTGGTGCTGTAGGTGCCCCTGGTCCTGCTGGAGCCACAGGTGACCGGGGCGAAGCTGGGGCTGCTGGTCCTGCTGGTCCTGCTGGTCCTCGGGGAAGCCCTGGTGAACGTGGTGAGGTCGGTCCTGCTGGCCCCAATGGATTTGCTGGTCCTGCTGGTGCTGCTGGTCAACCTGGTGCTAAAGGAGAAAGAGGAGCCAAAGGGCCTAAGGGTGAAAACGGTGTTGTTGGTCCCACAGGCCCCGTTGGAGCTGCTGGCCCAGCTGGTCCAAATGGTCCCCCCGGTCCTGCTGGAAGTCGTGGTGATGGAGGCCCCCCTGGTATGACTGGTTTCCCTGGTGCTGCTGGACGGACTGGTCCCCCAGGACCCTCTGGTATTTCTGGCCCTCCTGGTCCCCCTGGTCCTGCTGGGAAAGAAGGGCTTCGTGGTCCTCGTGGTGACCAAGGTCCAGTTGGCCGAACTGGAGAAGTAGGTGCAGTTGGTCCCCCTGGCTTCGCTGGTGAGAAGGGTCCCTCTGGAGAGGCTGGTACTGCTGGACCTCCTGGCACTCCAGGTCCTCAGGGTCTTCTTGGTGCTCCTGGTATTCTGGGTCTCCCTGGCTCGAGAGGTGAACGTGGTCTACCAGGTGTTGCTGGTGCTGTGGGTGAACCTGGTCCTCTTGGCATTGCCGGCCCTCCTGGGGCCCGTGGTCCTCCTGGTGCTGTGGGTAGTCCTGGAGTCAACGGTGCTCCTGGTGAAGCTGGTCGTGATGGCAACCCTGGGAACGATGGTCCCCCAGGTCGCGATGGTCAACCCGGACACAAGGGAGAGCGCGGTTACCCTGGCAATATTGGTCCCGTTGGTGCTGCAGGTGCACCTGGTCCTCATGGCCCCGTGGGTCCTGCTGGCAAACATGGAAACCGTGGTGAAACTGGTCCTTCTGGTCCTGTTGGTCCTGCTGGTGCTGTTGGCCCAAGAGGTCCTAGTGGCCCACAAGGCATTCGTGGCGATAAGGGAGAGCCCGGTGAAAAGGGGCCCAGAGGTCTTCCTGGCTTAAAGGGACACAATGGATTGCAAGGTCTGCCTGGTATCGCTGGTCACCATGGTGATCAAGGTGCTCCTGGCTCCGTGGGTCCTGCTGGTCCTAGGGGCCCTGCTGGTCCTTCTGGCCCTGCTGGAAAAGATGGTCGCACTGGACATCCTGGTACAGTTGGACCTGCTGGCATTCGAGGCCCTCAGGGTCACCAAGGCCCTGCTGGCCCCCCTGGTCCCCCTGGCCCTCCTGGACCTCCAGGTGTAAGCGGTGGTGGTTATGACTTTGGTTACGATGGAGACTTCTACAGGGCTGACCAGCCTCGCTCAGCACCTTCTCTCAGACCCAAGGACTATGAAGTTGATGCTACTCTGAAGTCTCTCAACAACCAGATTGAGACCCTTCTTACTCCTGAAGGCTCTAGAAAGAACCCAGCTCGCACATGCCGTGACTTGAGACTCAGCCACCCAGAGTGGAGCAGTGGTTACTACTGGATTGACCCTAACCAAGGATGCACTATGGATGCTATCAAAGTATACTGTGATTTCTCTACTGGCGAAACCTGTATCCGGGCCCAACCTGAAAACATCCCAGCCAAGAACTGGTATAGGAGCTCCAAGGACAAGAAACACGTCTGGCTAGGAGAAACTATCAATGCTGGCAGCCAGTTTGAATATAATGTAGAAGGAGTGACTTCCAAGGAAATGGCTACCCAACTTGCCTTCATGCGCCTGCTGGCCAACTATGCCTCTCAGAACATCACCTACCACTGCAAG