Transcript asmbl_121068

Sequence
Transcript Sequence for observation asmbl_121068 of TGE0056415:
CCCTTATTAGCCATATCAGTAATGTGCTGTGTGGGGGATTTTTTTTTTCTTTCAATTCCTCTGGCAACAAACCACACACTGGGATCTGACACTGTAGAGTGCTTTCTCTTCTCTTTTTTTGGGGGGGGGAGGGGGTGTGGTTGCATATTTAAACTCTCACGCATTTATGTACTGAGGACTGCAGTGTAGGACTTTCCTGCAGAATACCATTTGATCCTATTAAGAATTGTCCAAATGTTGGAGCATTTGATTGAAAAATCCTTCTTAGCCATTTTAAAGATAGCTTTCCAATGATTAGACGAATTGATTCTTTCTGTGACTCATCAGTTCATTTCCTGTAAAATTCATGTCTTGCTGTTGATTTGTGAATAAGAACCAGAGCTTGTAGAAACCACTTTAATCATATCCAGGAGTTTGCAAGAAACAGGTGCTTAACACTAATTCACCTCCTGAACAAGAAAAATGGGCTGTGACCGGAACTGTGGGCTCATCGCTGGGGCTGTCATTGGTGCTGTCCTGGCTGTGTTTGGAGGTATTCTAATGCCAGTTGGAGACCTGCTTATCCAGAAGACAATTAAAAAGCAAGTTGTCCTCGAAGAAGGTACAATTGCTTTTAAAAATTGGGTTAAAACAGGCACAGAAGTTTACAGACAGTTTTGGATCTTTGATGTGCAAAATCCACAGGAAGTGATGATGAACAGCAGCAACATTCAAGTTAAGCAAAGAGGTCCTTATACGTACAGAGTTCGTTTTCTAGCCAAGGAAAATGTAACCCAGGACGCTGAGGACAACACAGTCTCTTTCCTGCAGCCCAATGGTGCCATCTTCGAACCTTCACTATCAGTTGGAACAGAGGCTGACAACTTCACAGTTCTCAATCTGGCTGTGGCAGCTGCATCCCATATCTATCAAAATCAATTTGTTCAAATGATCCTCAATTCACTTATTAACAAGTCAAAATCTTCTATGTTCCAAGTCAGAACTTTGAGAGAACTGTTATGGGGCTATAGGGATCCATTTTTGAGTTTGGTTCCGTACCCTGTTACTACCACAGTTGGTCTGTTTTATCCTTACAACAATACTGCAGATGGAGTTTATAAAGTTTTCAATGGAAAAGATAACATAAGTAAAGTTGCCATAATCGACACATATAAAGGTAAAAGGAATCTGTCCTATTGGGAAAGTCACTGCGACATGATTAATGGTACAGATGCAGCCTCATTTCCACCTTTTGTTGAGAAAAGCCAGGTATTGCAGTTCTTTTCTTCTGATATTTGCAGGTCAATCTATGCTGTATTTGAATCCGACGTTAATCTGAAAGGAATCCCTGTGTATAGATTTGTTCTTCCATCCAAGGCCTTTGCCTCTCCAGTTGAAAACCCAGACAACTATTGTTTCTGCACAGAAAAAATTATCTCAAAAAATTGTACATCATATGGTGTGCTAGACATCAGCAAATGCAAAGAAGGGAGACCTGTGTACATTTCACTTCCTCATTTTCTGTATGCAAGTCCTGATGTTTCAGAACCTATTGATGGATTAAACCCAAATGAAGAAGAACATAGGACATACTTGGATATTGAACCTATAACTGGATTCACTTTACAATTTGCAAAACGGCTGCAGGTCAACCTATTGGTCAAGCCATCAGAAAAAATTCAAGTATTAAAGAATCTGAAGAGGAACTATATTGTGCCTATTCTTTGGCTTAATGAGACTGGGACCATTGGTGATGAGAAGGCAAACATGTTCAGAAGTCAAGTAACTGGAAAAATAAACCTCCTTGGCCTGATAGAAATGATCTTACTCAGTGTTGGTGTGGTGATGTTTGTTGCTTTTATGATTTCATATTGTGCATGCAGATCGAAAACAATAAAATAAGTAAGTATGTACCAAAAAATATTGCTTCAATAATATTAGCTTATATATTACTTGTTTTCACTTTATCAAAGAGAAGTTACATATTAGGCCATATATATTTCTAGACATGTCTAGCCACTGATCATTTTTAAATATAGGTAAATAAACCTATAAATATTATCACGCAGATCACTAAAGTATATCTTTAATTCTGGGAGAAATGAGATAAAAGATGTACTTGTGACCATTGTAACAATAGCACAAATAAAGCACTTGTGCCAAAGTTGTCCAAAATTGACTGGTTCATTTCTCAATTATATAGCTAGTTATATATTATCTGATACTTAAAAATAATTGACTAGGAAATGGTTTCATAAGACCAGGATTGCTGCATGTAGACATGCTGGCCGTGCATTTTCCAAATCCAGAAAAGTCCTGAACAAAAATTTGAATATAATAGTATCAGGAAATAGGGGAAAATAGTGTTCAACATAGTAGAACCAAGTACTCAGAGTGGTGTACAAGAGTTTAGGCCTCTATGCTTTAGATATTAGTGTCCATGCACTCTTAAAGATGAATGAATGCCTGACCTTTCCTAAAGGAAAACCTTTTTTTAGTTATCACAGGTAACATTGGTGTTGCCTGTGGGGGAGAATTTTTTACTTTCTCCCTATTTTTCTTCAGCCCACCTCAAGGCAATGTAAATAAAAGCAGTATGTGTGTTATAATAACTTATTTAGTTGTTTACTGTGTGCCAGTACCATGCTAAAGAAAGATTCTTTATCTCACATGATCCCTAATACAATTTCATGATTTTCCAATAGCCTGGATTCATCAGCATCCATTCTATCTTCTAGAGATGTTCCATGAAATCATACATTTTAATTGTTTGTGACCAAAGCATAAATCAGTGAAAGTGGAATTTGGGGACCAATAATTTCCTTTTGTGAGATGGAGAGCTTGTGTTTGAAAAGGCAACCTAATTTTTGGTTCTAATCACTTCTACCACTATTTAGTCACCAAAAAGACAATAATTCTGCATCCAAACTATTTGGACAGAATGGCTTCAAAATGCTAGCCTAAAATGTTCACATTATAAAAAGTTAAATATTACCTTCAATACCTGTCAGTAGCCTACTGACAAATTATGACTAAACAAAGGTATTTGTATGACTATGTAATAGATCATCCGCTGAAAAGTAAAACAAAATAACAAAAAAACTTGTCCTAATGGGAAAGCATGCTTAATAAAAGGAAATGCAGAAGTTATAAACATGTTTTGTAAGTAAGTATTCAGAATTAAAATTATGTGATACATTTTTATGATTGCTTAATGATCCTTGGATGTCAGATTCCTTGGGTCTATTTATAGCTAAATTATAATGAAAAATTCAAGGCTTGCTGGAGCAACTTTGTCAACAAATATATTAGTTTTGCTTATATATTTGATTTTTATGTGGAAAAATTACTACCCTTTTTTACAAGCAGAGAATAAACTGTTGATTACTTGATTTACTAGATTTAGAAGAATCACAAAAGATATGTAGATTTTCTTAAGCAAAATTCAGCTCTTAATATCATAAAAATTATATCTTTGGGCAGATTTGTAAACAATAGGAACAAGTAAGAAGACAGGTATGTAAGAAGTAGCAAAGTGTAAGACGGTGGAGCTTTAATGTGTGGTTTTACTCAGGGGGTCACAAGAAAATAACCCAATGGTCCTTTTGAAAGTAGTACATACACCTTTAAATGGAACTTGGTCTGAAGGGTGTGGAAATGCTGGTCCAGGGCAGATGCACTTCAGCTACCGTTCCTTGCCTGGTGTGTGCTTGTCTTGAAGCACCCTTCTTATGTGCCTTTCTGGAATGGGAATGTGTTTTGCCCTATTGGTGAAGTCCGTTAGAGAACTTCTCTCTGCAGCTAGAGAAACTGAACTGATTAATAAAAAGTATGATATCTAAGATATACTGCCACTCTACAGGTAGTAAATGATTCTTCACATTTGTGCGCCAGCTACATCATGACCCTTGGTAATACCGACCAACAGGATGAAAATTGGATATGCTTTACTTTTACAAAGCACACCTTATCTTTTAGTTGAAGAAATGGTGGCACTATTTCTTTTTTTGCACTAAGCAACTGCACATTTCAAAAGGATTATTGAGATGTTATGAAAATCTCTACCTTGCACAAAAAAAAACCCAGCAGCTTTTAAAATTCATCATTTCCACAACTGAATTGATTTCCGTTTCTACAGACCTGGCTCAAGCACAAACCAATTTGTGTTGTTCTGATTCAATAATTGGTTTCTGGGTGGCCAATTCAGAAGAAGAGTGTACATGCTCAACAAATCCTAGGCCCTGCATTCCTGTCATCCTCATCCGGGGGAAACACCATCATCCCAGTAGCTGCCCTATTCAACTGCAACAGTCTCCAGGACCATCAGTATACTGCATTTCATGTGCACCAAATATTTTGAAAGACATTTATAAATAATTGGCTTATGACTCATATTTCTCTATGAATACCTTCATACAGCAGGTATAACTCTTTTCTTTATGGGCTTAAATATTTTGTCACTGATCCTGCAAATGGACATCATTTTAGCACACTAGCGGTTTATATTTTAAGGACCTTCATTCTCTGTTCTGC