Transcript asmbl_121036

Sequence
Transcript Sequence for observation asmbl_121036 of TGE0002555:
TGCCACTTCTCAGTTGTATGCCCCAACCCAACCTGTCTGGCTCTGTCCTCCTTAACAGAAGGACGGCCCTGGCCACGGGCCACAGCCAGCAACGCTTAAGCACCAGGGCCGGCGAGTGCCCTGCCGTGGCACGGCTCCAGCGTCGCGCTCTCGAATTCATTTGCTTTCCTTAACGAGAGAAGGTTCCAGATGAGGGCTGAACCCTCTTCGCCCCGCCCACGGCCCCTGAACGCTGGGGGAGGAGTGCATGGGGAGGGGCGGCCCTCAAACGGGTCATTGCCATTAATAGAGACCTCAAACACCGCCTGCTAAAAATACCCGACTGGAGGAGCATAAAAGCGCAGCCGAGCCCAGCGCCCCGCACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCCCCTTCTCGCTCCTGCGGGGCCCCAGCTGGGACCCCTTCCGCGACTGGTACCCGCATAGCCGCCTCTTCGACCAGGCCTTCGGGCTGCCCCGGCTGCCGGAGGAGTGGTCGCAGTGGTTAGGCGGCAGCAGCTGGCCAGGCTACGTGCGCCCCCTGCCCCCCGCCGCCATCGAGAGCCCCGCAGTGGCCGCGCCCGCCTACAGCCGCGCGCTCAGCCGGCAACTCAGCAGCGGGGTCTCGGAGATCCGGCACACTGCGGACCGCTGGCGCGTGTCCCTGGATGTCAACCACTTCGCCCCGGACGAGCTGACGGTCAAGACCAAGGATGGCGTGGTGGAGATCACCGGCAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCCCGGTGCTTCACGCGGAAATACACGCTGCCCCCCGGTGTGGACCCCACCCAAGTTTCCTCCTCCCTGTCCCCTGAGGGCACACTGACCGTGGAGGCCCCCATGCCCAAGCTAGCCACGCAGTCCAACGAGATCACCATCCCAGTCACCTTCGAGTCGCGGGCCCAGCTTGGGGGCCCAGAAGCTGCAAAATCCGATGAGACTGCCGCCAAGTAAAGCCTTAGCCCGGATGCCCACCCCTGCTGCCGCCACTGGCTGTGCCTCCCCCGCCACCTGTGTGTTCTTTTGATACATTTATCTTCTGTTTTTCTCAAATAAAGTTCAAAGCAACCACCT