Transcript asmbl_120971

Sequence
Transcript Sequence for observation asmbl_120971 of TGE0056959:
TGTGTGCTTGTGTGCATGTGTGTGCGTGTGTGTGTCAAGGAAAAAAGCTCGCAGTCCAGCAGCCCGGGCCTGGGAGGCTTGTGAGCCGGGCCTTTCGTAATTGTCCCCTCCCCGCGGCCCCCTCCCCCAGGCCTCCCCCCTCTCCCGCCCTCCCGCCCGCCCTCTCTCCCTCCCTCTTTCCCTCACAGCCGACGAGGCAACAATTAGGCTTTGGGGATAAAACGAGGTGCGGAGAGCGGGCTGGGGCATTTCTCCCCGAGATGGCGGGTCTGACGGCGGCGGCCCCGCGGCCCGGAGTCCTCCTGCTCCTGCTGTCCATCCTCCACCCCTCTCGGCCTGGAGGGGTCCCTGGGGCCATTCCTGGTGGAGTTCCTGGAGGAGTCTTTTATCCAGGGGCTGGTCTCGGAGCCCTTGGAGGAGGAGCGCTGGGGCCTGGAGGCAAACCTCTTAAGCCAGTTCCCGGAGGGCTTGCGGGTGCTGGCCTTGGGGCAGGGCTCGGCGCCTTCCCCGCAGTTACCTTTCCGGGGGCTCTGGTGCCTGGTGGAGTGGCTGACGCTGCTGCAGCCTATAAAGCTGCTAAGGCTGGCGCTGGGCTTGGTGGTGTCCCAGGAGTTGGTGGCTTAGGAGTGTCTGCAGGTGCGGTGGTTCCTCAGCCTGGAGCCGGAGTGAAGCCTGGGAAAGTGCCGGGTGTGGGGCTGCCAGGTGTATACCCAGGTGGCGTGCTCCCAGGAGCTCGGTTCCCCGGTGTGGGGGTGCTCCCTGGAGTTCCCACTGGAGCAGGAGTTAAGCCCAAGGCTCCAGGTGTAGGTGGAGCTTTTGCTGGAATCCCAGGAGTTGGACCCTTTGGGGGACCGCAACCTGGAGTCCCACTGGGGTATCCCATCAAGGCCCCCAAGCTGCCTGGTGGCTATGGACTGCCCTACACCACAGGGAAACTGCCCTATGGCTATGGGCCCGGAGGAGTGGCTGGTGCAGCGGGCAAGGCTGGTTACCCAACAGGGACAGGGGTTGGCCCCCAGGCAGCAGCAGCAGCGGCAGCTAAAGCAGCAGCAAAGTTCGGTGCTGGAGCAGCCGGAGTCCTCCCTGGTGTTGGAGGGGCTGGTGTTCCTGGCGTGCCTGGGGCAATTCCTGGAATTGGAGGCATCGCAGGCGTTGGGACTCCAGCTGCAGCTGCAGCTGCAGCAGCAGCCGCTAAGGCAGCCAAGTATGGAGCTGCTGCAGGCTTAGTGCCTGGTGGGCCAGGCTTTGGCCCGGGAGTAGTTGGTGTCCCAGGAGCTGGCGTTCCAGGTGTTGGTGTCCCAGGAGCTGGGATTCCAGTTGTCCCAGGTGCTGGGATCCCAGGTGCTGCGGTTCCAGGGGTTGTGTCACCAGAAGCAGCTGCTAAGGCAGCTGCAAAGGCAGCCAAATACGGGGCCAGGCCCGGAGTCGGAGTTGGAGGCATTCCTACTTACGGGGTTGGAGCTGGGGGCTTTCCCGGCTTTGGTGTCGGAGTCGGAGGTATCCCTGGAGTCGCAGGTGTCCCTGGTGTCGGAGGTGTTCCCGGAGTCGGAGGTGTCCCGGGAGTTGGCATTTCCCCCGAAGCTCAGGCAGCAGCTGCCGCCAAGGCTGCCAAGTACGGAGTGGGGACCCCAGCAGCTGCAGCTGCTAAAGCAGCCGCCAAAGCCGCCCAGTTTGGGTTAGTTCCTGGTGTCGGCGTGGCTCCTGGAGTTGGCGTGGCTCCTGGTGTCGGTGTGGCTCCTGGAGTTGGCTTGGCTCCTGGAGTTGGCGTGGCTCCTGGAGTTGGTGTGGCTCCTGGCGTTGGCGTGGCTCCCGGCATTGGCCCTGGTGGAGTTGCAGCTGCAGCAAAATCCGCTGCCAAGGTGGCTGCCAAAGCCCAGCTCCGAGCTGCAGCTGGGCTTGGTGCTGGCATCCCTGGACTTGGAGTTGGTGTCGGCGTCCCTGGACTTGGAGTTGGTGCTGGTGTTCCTGGACTTGGAGTTGGTGCTGGTGTTCCTGGCTTCGGGGCAGGTGCAGATGAGGGAGTTAGGCGGAGCCTGTCCCCTGAGCTCAGGGAAGGAGATCCCTCCTCCTCTCAGCACCTCCCCAGCACCCCCTCATCACCCAGGGGTGCATAGTAAAATCCTTGTTAGGTTCTCCTAAGCATCTGGGGGTAACAGATAGCGGGAGGAGGGCAGACCAGGCCAAGGGACCCCAGGCTGCCCAATTGCAGAGTATCTGCCTCCTCAGTAGAGGGGTGGCAGGGCTCCAGACTGAGAAAAAGCCTGCCCTCCAACCAGGGAAGGAGCAGGTAGATCAGCCTGGCTCCCCTTCAGCAGTGCTCTGTGGCCAGGGGACCACTAGGAACTCCAGTTCTTCACCAGCTGGTGACTGAGCCCCACTCTGTGCCCAGCCTCAGGCAGTCCATGCTAGGCCTGGGGAGAGAAGGAAGGGGCAGACGGAAGGTGGAGGCACTGTTCAGCCCTAAAGCTCTGTGCCTGTACAGCTTCAGGGCTTTGAGGAAGCAATAGAGGCCAAGGAAGTCAGGGAGGGCTCTCTAGAGGAGGCGGCAGAACTCCCAGGCACAGAGCTCGGCTCCTGACCACTCCCCAACTTTTCTTTCTCCCCAGTACCTGGAGCCCTGGCTGCCGCTAAAGCAGCCAAATATGGTGAGTGCACCCCACAACCACTTGTGGCTCCCTTGCCACCACACCATCCCTGACAGCACAGGACTGGGGTGGTCACAATAGAAAAAGGCAGTTTCGGCCGGGC