Transcript asmbl_120969

Sequence
Transcript Sequence for observation asmbl_120969 of TGE0056958:
TGTGTGCTTGTGTGCATGTGTGTGCGTGTGTGTGTCAAGGAAAAAAGCTCGCAGTCCAGCAGCCCGGGCCTGGGAGGCTTGTGAGCCGGGCCTTTCGTAATTGTCCCCTCCCCGCGGCCCCCTCCCCCAGGCCTCCCCCCTCTCCCGCCCTCCCGCCCGCCCTCTCTCCCTCCCTCTTTCCCTCACAGCCGACGAGGCAACAATTAGGCTTTGGGGATAAAACGAGGTGCGGAGAGCGGGCTGGGGCATTTCTCCCCGAGATGGCGGGTCTGACGGCGGCGGCCCCGCGGCCCGGAGTCCTCCTGCTCCTGCTGTCCATCCTCCACCCCTCTCGGCCTGGAGGGGTCCCTGGGGCCATTCCTGGTGGAGTTCCTGGAGGAGTCTTTTATCCAGGGGCTGGTCTCGGAGCCCTTGGAGGAGGAGCGCTGGGGCCTGGAGGCAAACCTCTTAAGCCAGTTCCCGGAGGGCTTGCGGGTGCTGGCCTTGGGGCAGGGCTCGGCGCCTTCCCCGCAGTTACCTTTCCGGGGGCTCTGGTGCCTGGTGGAGTGGCTGACGCTGCTGCAGCCTATAAAGCTGCTAAGGCTGGCGCTGGGCTTGGTGGTGTCCCAGGAGTTGGTGGCTTAGGAGTGTCTGCAGGTGCGGTGGTTCCTCAGCCTGGAGCCGGAGTGAAGCCTGGGAAAGTGCCGGGTGTGGGGCTGCCAGGTGTATACCCAGGTGGCGTGCTCCCAGGAGCTCGGTTCCCCGGTGTGGGGGTGCTCCCTGGAGTTCCCACTGGAGCAGGAGTTAAGCCCAAGGCTCCAGGTGTAGGTGGAGCTTTTGCTGGAATCCCAGGAGTTGGACCCTTTGGGGGACCGCAACCTGGAGTCCCACTGGGGTATCCCATCAAGGCCCCCAAGCTGCCTGGTGGCTATGGACTGCCCTACACCACAGGGAAACTGCCCTATGGCTATGGGCCCGGAGGAGTGGCTGGTGCAGCGGGCAAGGCTGGTTACCCAACAGGGACAGGGGTTGGCCCCCAGGCAGCAGCAGCAGCGGCAGCTAAAGCAGCAGCAAAGTTCGGTGCTGGAGCAGCCGGAGTCCTCCCTGGTGTTGGAGGGGCTGGTGTTCCTGGCGTGCCTGGGGCAATTCCTGGAATTGGAGGCATCGCAGGCGTTGGGACTCCAGCTGCAGCTGCAGCTGCAGCAGCAGCCGCTAAGGCAGCCAAGTATGGAGCTGCTGCAGGCTTAGTGCCTGGTGGGCCAGGCTTTGGCCCGGGAGTAGTTGGTGTCCCAGGAGCTGGCGTTCCAGGTGTTGGTGTCCCAGGAGCTGGGATTCCAGTTGTCCCAGGTGCTGGGATCCCAGGTGCTGCGGTTCCAGGGGTTGTGTCACCAGAAGCAGCTGCTAAGGCAGCTGCAAAGGCAGCCAAATACGGGGCCAGGCCCGGAGTCGGAGTTGGAGGCATTCCTACTTACGGGGTTGGAGCTGGGGGCTTTCCCGGCTTTGGTGTCGGAGTCGGAGGTATCCCTGGAGTCGCAGGTGTCCCTGGTGTCGGAGGTGTTCCCGGAGTCGGAGGTGTCCCGGGAGTTGGCATTTCCCCCGAAGCTCAGGCAGCAGCTGCCGCCAAGGCTGCCAAGTACGGAGTGGGGACCCCAGCAGCTGCAGCTGCTAAAGCAGCCGCCAAAGCCGCCCAGTTTGGGTTAGTTCCTGGTGTCGGCGTGGCTCCTGGAGTTGGCGTGGCTCCTGGTGTCGGTGTGGCTCCTGGAGTTGGCTTGGCTCCTGGAGTTGGCGTGGCTCCTGGAGTTGGTGTGGCTCCTGGCGTTGGCGTGGCTCCCGGCATTGGCCCTGGTGGAGTTGCAGCTGCAGCAAAATCCGCTGCCAAGGTGGCTGCCAAAGCCCAGCTCCGAGCTGCAGCTGGGCTTGGTGCTGGCATCCCTGGACTTGGAGTTGGTGTCGGCGTCCCTGGACTTGGAGTTGGTGCTGGTGTTCCTGGACTTGGAGTTGGTGCTGGTGTTCCTGGCTTCGGGGCAGTACCTGGAGCCCTGGCTGCCGCTAAAGCAGCCAAATATGGAGCAGCAGTGCCTGGGGTCCTTGGAGGGCTCGGGGCTCTCGGTGGAGTAGGCATCCCAGGCGGTGTGGTGGGAGCCGGACCCGCCGCCGCCGCTGCCGCAGCCAAAGCTGCTGCCAAAGCCGCCCAGTTTGGCCTAGTGGGAGCCGCTGGGCTCGGAGGACTCGGAGTCGGAGGGCTTGGAGTTCCAGGTGTTGGGGGCCTTGGAGGTATACCTCCAGCTGCAGCCGCTAAAGCAGCTAAATACGGAGTGGCAGCAAGACCTGGCTTCGGATTGTCTCCCATTTTCCCAGGTGGGGCCTGCCTGGGGAAAGCTTGTGGCCGGAAGAGAAAATGAGCTTCCTAGGACCCCTGACTCACGACCTCATCAACGTTGGTGCTACTGCTTGGTGGAGAATGTAAACCCTTTGTAACCCCATCCCATGCCCCTCCGACTCCCCACCCCAGGAGGGAACGGGCAGGCCGGGCGGCCTTGCAGATCCACAGGGCAAGGAAACAAGAGGGGAGCGGCCAAGTGCCCCGACCAGGAGGCCCCCTACTTCAGAGGCAAGGGCCATGTGGTCCTGGCCCCCCACCCCATCCCTTCCCACCTAGGAGCTCCCCCTCCACACAGCCTCCATCTCCAGGGGAACTTGGTGCTACACGCTGGTGCTCTTATCTTCCTGGGGGGAGGGAGGAGGGAAGGGTGGCCCCTCGGGGAACCCCCTACCTGGGGCTCCTCTAAAGATGGTGCAGACACTTCCTGGGCAGTCCCAGCTCCCCCTGCCCACCAGGACCCACCGTTGGCTGCCATCCAGTTGGTACCCAAGCACCTGAAGCCTCAAAGCTGGATTCGCTCTAGCATCCCTCCTCTCCTGGGTCCACTTGGCCGTCTCCTCCCCACCGATCGCTGTTCCCCACATCTGGGGCGCTTTTGGGTTGGAAAACCACCCCACACTGGGAATAGCCACCTTGCCCTTGTAGAATCCATCCGCCCATCCGTCCATTCATCCATCGGTCCGTCCATCCATGTCCCCAGTTGACCGCCCGGCACCACTAGCTGGCTGGGTGCACCCACCATCAACCTGGTTGACCTGTCATGGCCGCCTGTGCCCTGCCTCCACCCCCATCCTACACTCCCCCAGGGCGTGCGGGGCTGTGCAGACTGGGGTGCCAGGCATCTCCTCCCCACCCGGGGTGTCCCCACATGCAGTACTGTATACCCCCCATCCCTCCCTCGGTCCACTGAACTTCAGAGCAGTTCCCATTCCTGCCCCGCCCATCTTTTTGTGTCTCGCTGTGATAGATCAATAAATATTTTATTTTTTGTCCTGGATATTTGGGGATTATTTTTGATTGTTGATATTCTCTTTTGGTTTTATTGTTGTGGTTCATTGAAAAAAAAAGATAATTTTTTTTTCTGATCCGGGGAGCTGTATCCCCAGTAGAAAAAACATTTTAATCACTCTAATATAACTCTGGATGAAACACACCTTTTTTTTTAATAAGAAAAGAGAATTAACTGCTTCAGAAATGACTAATAAATGAAAAACCTTTAAAGGAAA