Transcript asmbl_120968

Sequence
Transcript Sequence for observation asmbl_120968 of TGE0056957:
TGTGTGCTTGTGTGCATGTGTGTGCGTGTGTGTGTCAAGGAAAAAAGCTCGCAGTCCAGCAGCCCGGGCCTGGGAGGCTTGTGAGCCGGGCCTTTCGTAATTGTCCCCTCCCCGCGGCCCCCTCCCCCAGGCCTCCCCCCTCTCCCGCCCTCCCGCCCGCCCTCTCTCCCTCCCTCTTTCCCTCACAGCCGACGAGGCAACAATTAGGCTTTGGGGATAAAACGAGGTGCGGAGAGCGGGCTGGGGCATTTCTCCCCGAGATGGCGGGTCTGACGGCGGCGGCCCCGCGGCCCGGAGTCCTCCTGCTCCTGCTGTCCATCCTCCACCCCTCTCGGCCTGGAGGGGTCCCTGGGGCCATTCCTGGTGGAGTTCCTGGAGGAGTCTTTTATCCAGGGGCTGGTCTCGGAGCCCTTGGAGGAGGAGCGCTGGGGCCTGGAGGCAAACCTCTTAAGCCAGTTCCCGGAGGGCTTGCGGGTGCTGGCCTTGGGGCAGGGCTCGGCGCCTTCCCCGCAGTTACCTTTCCGGGGGCTCTGGTGCCTGGTGGAGTGGCTGACGCTGCTGCAGCCTATAAAGCTGCTAAGGCTGGCGCTGGGCTTGGTGGTGTCCCAGGAGTTGGTGGCTTAGGAGTGTCTGCAGGTGCGGTGGTTCCTCAGCCTGGAGCCGGAGTGAAGCCTGGGAAAGTGCCGGGTGTGGGGCTGCCAGGTGTATACCCAGGTGGCGTGCTCCCAGGAGCTCGGTTCCCCGGTGTGGGGGTGCTCCCTGGAGTTCCCACTGGAGCAGGAGTTAAGCCCAAGGCTCCAGGTGTAGGTGGAGCTTTTGCTGGAATCCCAGGAGTTGGACCCTTTGGGGGACCGCAACCTGGAGTCCCACTGGGGTATCCCATCAAGGCCCCCAAGCTGCCTGGTGGCTATGGACTGCCCTACACCACAGGGAAACTGCCCTATGGCTATGGGCCCGGAGGAGTGGCTGGTGCAGCGGGCAAGGCTGGTTACCCAACAGGGACAGGGGTTGGCCCCCAGGCAGCAGCAGCAGCGGCAGCTAAAGCAGCAGCAAAGTTCGGTGCTGGAGCAGCCGGAGTCCTCCCTGGTGTTGGAGGGGCTGGTGTTCCTGGCGTGCCTGGGGCAATTCCTGGAATTGGAGGCATCGCAGGCGTTGGGACTCCAGCTGCAGCTGCAGCTGCAGCAGCAGCCGCTAAGGCAGCCAAGTATGGAGCTGCTGCAGGCTTAGTGCCTGGTGGGCCAGGCTTTGGCCCGGGAGTAGTTGGTGTCCCAGGAGCTGGCGTTCCAGGTGTTGGTGTCCCAGGAGCTGGGATTCCAGTTGTCCCAGGTGCTGGGATCCCAGGTGCTGCGGTTCCAGGGGTTGTGTCACCAGAAGCAGCTGCTAAGGCAGCTGCAAAGGCAGCCAAATACGGGGCCAGGCCCGGAGTCGGAGTTGGAGGCATTCCTACTTACGGGGTTGGAGCTGGGGGCTTTCCCGGCTTTGGTGTCGGAGTCGGAGGTATCCCTGGAGTCGCAGGTGTCCCTGGTGTCGGAGGTGTTCCCGGAGTCGGAGGTGTCCCGGGAGTTGGCATTTCCCCCGAAGCTCAGGCAGCAGCTGCCGCCAAGGCTGCCAAGTACGGAGTGGGGACCCCAGCAGCTGCAGCTGCTAAAGCAGCCGCCAAAGCCGCCCAGTTTGGGTTAGTTCCTGGTGTCGGCGTGGCTCCTGGAGTTGGCGTGGCTCCTGGTGTCGGTGTGGCTCCTGGAGTTGGCTTGGCTCCTGGAGTTGGCGTGGCTCCTGGAGTTGGTGTGGCTCCTGGCGTTGGCGTGGCTCCCGGCATTGGCCCTGGTGGAGTTGCAGCTGCAGCAAAATCCGCTGCCAAGGTGGCTGCCAAAGCCCAGCTCCGAGCTGCAGCTGGGCTTGGTGCTGGCATCCCTGGACTTGGAGTTGGTGTCGGCGTCCCTGGACTTGGAGTTGGTGCTGGTGTTCCTGGACTTGGAGTTGGTGCTGGTGTTCCTGGCTTCGGGGCAGTACCTGGAGCCCTGGCTGCCGCTAAAGCAGCCAAATATGGAGCAGCAGTGCCTGGGGTCCTTGGAGGGCTCGGGGCTCTCGGTGGAGTAGGCATCCCAGGCGGTGTGGTGGGAGCCGGACCCGCCGCCGCCGCTGCCGCAGCCAAAGCTGCTGCCAAAGCCGCCCAGTTTGGCCTAGTGGGAGCCGCTGGGCTCGGAGGACTCGGAGTCGGAGGGCTTGGAGTTCCAGGTGTTGGGGGCCTTGGAGGTATACCTCCAGCTGCAGCCGCTAAAGCAGCTAAATACGGTGCTGCTGGCCTTGGAGGTGTCCTAGGGGGTGCCGGGCAGTTCCCACTTGGAGGAGTGGCAGCAAGACCTGGCTTCGGATTGTCTCCCATTTTCCCAGGTGGGGCCTGCCTGGGGAAAGCTTGTGGCCGGAAGAGAAAATGAGCTTCCTAGGACCCCTGACTCACGACCTCATCAACGTTGGTGCTACTGCTTGGTGGAGAATGTAAACCCTTTGTAACCCCATCCCATGCCCCTCCGACTCCCCACCCCAGGAGGGAACGGGCAGGCCGGGCGGCCTTGCAGATCCACAGGGCAAGGAAACAAGAGGGGAGCGGCCAAGTGCCCCGACCAGGAGGCCCCCTACTTCAGAGGCAAGGGCCATGTGGTCCTGGCCCCCCACCCCATCCCTTCCCACCTAGGAGCTCCCCCTCCACACAGCCTCCATCTCCAGGGGAACTTGGTGCTACACGCTGGTGCTCTTATCTTCCTGGGGGGAGGGAGGAGGGAAGGGTGGCCCCTCGGGGAACCCCCTACCTGGGGCTCCTCTAAAGATGGTGCAGACACTTCCTGGGCAGTCCCAGCTCCCCCTGCCCACCAGGACCCACCGTTGGCTGCCATCCAGTTGGTACCCAAGCACCTGAAGCCTCAAAGCTGGATTCGCTCTAGCATCCCTCCTCTCCTGGGTCCACTTGGCCGTCTCCTCCCCACCGATCGCTGTTCCCCACATCTGGGGCGCTTTTGGGTTGGAAAACCACCCCACACTGGGAATAGCCACCTTGCCCTTGTAGAATCCATCCGCCCATCCGTCCATTCATCCATCGGTCCGTCCATCCATGTCCCCAGTTGACCGCCCGGCACCACTAGCTGGCTGGGTGCACCCACCATCAACCTGGTTGACCTGTCATGGCCGCCTGTGCCCTGCCTCCACCCCCATCCTACACTCCCCCAGGGCGTGCGGGGCTGTGCAGACTGGGGTGCCAGGCATCTCCTCCCCACCCGGGGTGTCCCCACATGCAGTACTGTATACCCCCCATCCCTCCCTCGGTCCACTGAACTTCAGAGCAGTTCCCATTCCTGCCCCGCCCATCTTTTTGTGTCTCGCTGTGATAGATCAATAAATATTTTATTTTTTGTCCTGGATATTTGGGGATTATTTTTGATTGTTGATATTCTCTTTTGGTTTTATTGTTGTGGTTCATTGAAAAAAAAAGATAATTTTTTTTTCTGATCCGGGGAGCTGTATCCCCAGTAGAAAAAACATTTTAATCACTCTAATATAACTCTGGATGAAACACACCTTTTTTTTTAATAAGAAAAGAGAATTAACTGCTTCAGAAATGACTAATAAATGAAAAACCTTTAAAGGAAA