Transcript asmbl_120967

Sequence
Transcript Sequence for observation asmbl_120967 of TGE0056956:
TGTGTGCTTGTGTGCATGTGTGTGCGTGTGTGTGTCAAGGAAAAAAGCTCGCAGTCCAGCAGCCCGGGCCTGGGAGGCTTGTGAGCCGGGCCTTTCGTAATTGTCCCCTCCCCGCGGCCCCCTCCCCCAGGCCTCCCCCCTCTCCCGCCCTCCCGCCCGCCCTCTCTCCCTCCCTCTTTCCCTCACAGCCGACGAGGCAACAATTAGGCTTTGGGGATAAAACGAGGTGCGGAGAGCGGGCTGGGGCATTTCTCCCCGAGATGGCGGGTCTGACGGCGGCGGCCCCGCGGCCCGGAGTCCTCCTGCTCCTGCTGTCCATCCTCCACCCCTCTCGGCCTGGAGGGGTCCCTGGGGCCATTCCTGGTGGAGTTCCTGGAGGAGTCTTTTATCCAGGGGCTGGTCTCGGAGCCCTTGGAGGAGGAGCGCTGGGGCCTGGAGGCAAACCTCTTAAGCCAGTTCCCGGAGGGCTTGCGGGTGCTGGCCTTGGGGCAGGGCTCGGCGCCTTCCCCGCAGTTACCTTTCCGGGGGCTCTGGTGCCTGGTGGAGTGGCTGACGCTGCTGCAGCCTATAAAGCTGCTAAGGCTGGCGCTGGGCTTGGTGGTGTCCCAGGAGTTGGTGGCTTAGGAGTGTCTGCAGGTGCGGTGGTTCCTCAGCCTGGAGCCGGAGTGAAGCCTGGGAAAGTGCCGGGTGTGGGGCTGCCAGGTGTATACCCAGGTGGCGTGCTCCCAGGAGCTCGGTTCCCCGGTGTGGGGGTGCTCCCTGGAGTTCCCACTGGAGCAGGAGTTAAGCCCAAGGCTCCAGGTGTAGGTGGAGCTTTTGCTGGAATCCCAGGAGTTGGACCCTTTGGGGGACCGCAACCTGGAGTCCCACTGGGGTATCCCATCAAGGCCCCCAAGCTGCCTGGTGGCTATGGACTGCCCTACACCACAGGGAAACTGCCCTATGGCTATGGGCCCGGAGGAGTGGCTGGTGCAGCGGGCAAGGCTGGTTACCCAACAGGGACAGGGGTTGGCCCCCAGGCAGCAGCAGCAGCGGCAGCTAAAGCAGCAGCAAAGTTCGGTGCTGGAGCAGCCGGAGTCCTCCCTGGTGTTGGAGGGGCTGGTGTTCCTGGCGTGCCTGGGGCAATTCCTGGAATTGGAGGCATCGCAGGCGTTGGGACTCCAGCTGCAGCTGCAGCTGCAGCAGCAGCCGCTAAGGCAGCCAAGTATGGAGCTGCTGCAGGCTTAGTGCCTGGTGGGCCAGGCTTTGGCCCGGGAGTAGTTGGTGTCCCAGGAGCTGGCGTTCCAGGTGTTGGTGTCCCAGGAGCTGGGATTCCAGTTGTCCCAGGTGCTGGGATCCCAGGTGCTGCGGTTCCAGGGGTTGTGTCACCAGAAGCAGCTGCTAAGGCAGCTGCAAAGGCAGCCAAATACGGGGCCAGGCCCGGAGTCGGAGTTGGAGGCATTCCTACTTACGGGGTTGGAGCTGGGGGCTTTCCCGGCTTTGGTGTCGGAGTCGGAGGTATCCCTGGAGTCGCAGGTGTCCCTGGTGTCGGAGGTGTTCCCGGAGTCGGAGGTGTCCCGGGAGTTGGCATTTCCCCCGAAGCTCAGGCAGCAGCTGCCGCCAAGGCTGCCAAGTACGGGTTAGTTCCTGGTGTCGGCGTGGCTCCTGGAGTTGGCGTGGCTCCTGGTGTCGGTGTGGCTCCTGGAGTTGGCTTGGCTCCTGGAGTTGGCGTGGCTCCTGGAGTTGGTGTGGCTCCTGGCGTTGGCGTGGCTCCCGGCATTGGCCCTGGTGGAGTTGCAGCTGCAGCAAAATCCGCTGCCAAGGTGGCTGCCAAAGCCCAGCTCCGAGCTGCAGCTGGGCTTGGTGCTGGCATCCCTGGACTTGGAGTTGGTGTCGGCGTCCCTGGACTTGGAGTTGGTGCTGGTGTTCCTGGACTTGGAGTTGGTGCTGGTGTTCCTGGCTTCGGGGCAGTACCTGGAGCCCTGGCTGCCGCTAAAGCAGCCAAATATGGAGCAGCAGTGCCTGGGGTCCTTGGAGGGCTCGGGGCTCTCGGTGGAGTAGGCATCCCAGGCGGTGTGGTGGGAGCCGGACCCGCCGCCGCCGCTGCCGCAGCCAAAGCTGCTGCCAAAGCCGCCCAGTTTGGCCTAGTGGGAGCCGCTGGGCTCGGAGGACTCGGAGTCGGAGGGCTTGGAGTTCCAGGTGTTGGGGGCCTTGGAGGTATACCTCCAGCTGCAGCCGCTAAAGCAGCTAAATACGGTGCTGCTGGCCTTGGAGGTGTCCTAGGGGGTGCCGGGCAGTTCCCACTTGGAGGAGTGGCAGCAAGACCTGGCTTCGGATTGTCTCCCATTTTCCCAGGTGGGGCCTGCCTGGGGAAAGCTTGTGGCCGGAAGAGAAAATGAGCTTCCTAGGACCCCTGACTCACGACCTCATCAACGTTGGTGCTACTGCTTGGTGGAGAATGTAAACCCTTTGTAACCCCATCCCATGCCCCTCCGACTCCCCACCCCAGGAGGGAACGGGCAGGCCGGGCGGCCTTGCAGATCCACAGGGCAAGGAAACAAGAGGGGAGCGGCCAAGTGCCCCGACCAGGAGGCCCCCTACTTCAGAGGCAAGGGCCATGTGGTCCTGGCCCCCCACCCCATCCCTTCCCACCTAGGAGCTCCCCCTCCACACAGCCTCCATCTCCAGGGGAACTTGGTGCTACACGCTGGTGCTCTTATCTTCCTGGGGGGAGGGAGGAGGGAAGGGTGGCCCCTCGGGGAACCCCCTACCTGGGGCTCCTCTAAAGATGGTGCAGACACTTCCTGGGCAGTCCCAGCTCCCCCTGCCCACCAGGACCCACCGTTGGCTGCCATCCAGTTGGTACCCAAGCACCTGAAGCCTCAAAGCTGGATTCGCTCTAGCATCCCTCCTCTCCTGGGTCCACTTGGCCGTCTCCTCCCCACCGATCGCTGTTCCCCACATCTGGGGCGCTTTTGGGTTGGAAAACCACCCCACACTGGGAATAGCCACCTTGCCCTTGTAGAATCCATCCGCCCATCCGTCCATTCATCCATCGGTCCGTCCATCCATGTCCCCAGTTGACCGCCCGGCACCACTAGCTGGCTGGGTGCACCCACCATCAACCTGGTTGACCTGTCATGGCCGCCTGTGCCCTGCCTCCACCCCCATCCTACACTCCCCCAGGGCGTGCGGGGCTGTGCAGACTGGGGTGCCAGGCATCTCCTCCCCACCCGGGGTGTCCCCACATGCAGTACTGTATACCCCCCATCCCTCCCTCGGTCCACTGAACTTCAGAGCAGTTCCCATTCCTGCCCCGCCCATCTTTTTGTGTCTCGCTGTGATAGATCAATAAATATTTTATTTTTTGTCCTGGATATTTGGGGATTATTTTTGATTGTTGATATTCTCTTTTGGTTTTATTGTTGTGGTTCATTGAAAAAAAAAGATAATTTTTTTTTCTGATCCGGGGAGCTGTATCCCCAGTAGAAAAAACATTTTAATCACTCTAATATAACTCTGGATGAAACACACCTTTTTTTTTAATAAGAAAAGAGAATTAACTGCTTCAGAAATGACTAATAAATGAAAAACCTTTAAAGGAAA