Transcript asmbl_119921

Sequence
Transcript Sequence for observation asmbl_119921 of TGE0009126:
CTTTCCCTCCGCGCCCTCCCCTCTCCTTTCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACCTGCGGAGAAAAAAAATTACTTATTTTCTTGCCCCATACATACCTTGAGGCGAGCAAAAAAATTAAATTTTAACCATGAGGGAAATCGTGCACATCCAGGCTGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGATCAGTGATGAACATGGCATCGACCCCACCGGCACCTACCACGGGGACAGCGACCTGCAGCTGGACCGCATCTCTGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCCATCCTGGTGGATCTAGAACCTGGGACCATGGACTCTGTTCGCTCAGGTCCTTTTGGCCAGATCTTTAGACCAGACAACTTTGTATTTGGTCAGTCTGGGGCAGGTAACAACTGGGCCAAAGGCCACTACACAGAGGGCGCCGAGCTGGTTGATTCTGTCCTGGATGTGGTACGGAAGGAGGCAGAGAGCTGTGACTGCCTGCAGGGCTTCCAGCTGACCCACTCACTGGGCGGGGGCACAGGCTCTGGAATGGGCACTCTCCTTATCAGCAAGATCCGAGAAGAATACCCTGATCGCATCATGAATACCTTCAGTGTGGTGCCTTCACCCAAAGTGTCTGACACCGTGGTCGAGCCCTACAATGCCACCCTCTCCGTCCATCAGTTGGTAGAGAATACTGATGAGACCTATTGCATTGACAACGAGGCCCTCTATGATATCTGCTTCCGCACTCTGAAGCTGACCACACCAACCTACGGGGATCTGAACCACCTTGTCTCAGCCACCATGAGTGGTGTCACCACCTGCCTCCGTTTCCCTGGCCAGCTCAATGCTGACCTCCGCAAGTTGGCAGTCAACATGGTCCCCTTCCCACGTCTCCATTTCTTTATGCCTGGCTTTGCCCCTCTCACCAGCCGTGGAAGCCAGCAGTATCGAGCTCTCACAGTGCCGGAACTCACCCAGCAGGTCTTCGATGCCAAGAACATGATGGCTGCCTGTGACCCCCGCCACGGCCGATACCTCACCGTGGCTGCTGTCTTCCGTGGTCGGATGTCCATGAAGGAGGTCGATGAGCAGATGCTTAACGTGCAGAACAAGAACAGCAGCTACTTTGTGGAATGGATCCCCAACAATGTCAAGACAGCCGTCTGTGACATCCCACCTCGTGGCCTCAAGATGGCAGTCACCTTCATTGGCAATAGCACAGCCATCCAGGAGCTCTTCAAGCGCATCTCGGAGCAGTTCACTGCCATGTTCCGCCGGAAGGCCTTCCTCCACTGGTACACAGGCGAGGGCATGGACGAGATGGAGTTCACCGAGGCTGAGAGCAACATGAACGACCTCGTCTCTGAGTATCAGCAGTACCAGGATGCCACCGCAGAAGAGGAGGAGGATTTCGGTGAGGAGGCCGAAGAGGAGGCCTAAGGCAGAGCCCCCATCACCTCAGGCTTCTCAGTTCCCTTAGCCGTCTTACTCAACTGCCCCTTTCCTCTCCCTCAGAATTTGTGTTTGCTGCCTCTATCTTGTTTTTTGTTTTTTCTTCTGGGGGGGGGTCTAGAACAGTGCCTGGCACATAGTAGGCGCTCAATAAATACTTGTTTGTTGAATGTCTCCTCTCTCTTTCCACTCTGGGAAACCTAGGTTTCTGCCATTCTGGGTGACCCTGTATTTCTTTCTGGTGCCCATTCCATTTGTCCAGTTAATACTTCCTCTTAAAAATCTCCAAGAAGCTGGGTCTCCAGATCCCATTTAGAACCAACCAGGTGCTGAAAACACATGTAGATAATGGCCATCATCCTAAGCCCAAAGTAGAAAATGGTAGAAGGTAGTGGGTAGAAGTCACTATATAAGGAAGGGGATGGGATTTTCCATTCTAAAAGTTTTGGAGAGGGAAATCCAGGCTATTAAAGTCACTAAATTTCTAAGTATGTCCATTTCCCATCTCAGCTTCAAGGGAGGTGTCAGCAGTATTATCTCCACTTTCAATCTCCCTCCAAGCTCTACTCTGGAGGAGTCTGTCCCACTCTGTCAAGTGGAATCCTTCCCTTTCCAACTCTACCTCCCTCACTCAGCTCCTTTCCCCTGATCAGAGAAAGGGATCAAGGGGGTTGGGAGGGGGGAAAGAGACCAGCCTTGGTCCCTAAGCCTCCAGAAACGTCTTCTTAATCCCCACCTTTTCTTACTCCCAAAAAAGAATGAACACCCCTGACTCTGGAGTGGTGTATACTGCCACATCAGTGTTTGAGTCAGTCCCCAGAGGAGAGGGGAACCCTCCTCCATCTTTTTTGCAACATCTCATTTCTTCCTTTTGCTGTTGCTTCCCCCCTCACACACTTGGTTTTGTTCTATCCTACATTTGAGATTTCTATTTTATGTTGAACTTGCTGCTTTTTTTCATATTGAAAAGATGACATCGCCCCAAGAGCCAAAAATAAATGGGAATTGAAAAA